MAL2 cloning plasmid

• Catalog number
  CSB-CL846573HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the MAL2 gene.
• Specifications
  Gene name: MAL2; Gene ID: 114569; Accession number: BC012367; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 531; Sequence: atgtcggccggcggagcgtcagtcccgccgcccccgaaccccgccgtgtccttcccgccgccccgggtcaccctgcccgccggccccgacatcctgcggacctactcgggcgccttcgtctgcctggagattctgttcgggggtcttgtctggattttggttgcctcctccaatgttcctctacctctactacaaggatgggtcatgtttgtgtccgtgacagcgtttttcttttcgctcctctttctgggcatgttcctctctggcatggtggctcaaattgatgctaactggaacttcctggattttgcctaccattttacagtatttgtcttctattttggagcctttttattggaagcagcagccacatccctgcatgatttgcattgcaatacaaccataaccgggcagccactcctgagtgataaccagtataacataaacgtagcagcctcaatttttgcctttatgacgacagcttgttatggttgcagtttgggtctggctttacgaagatggcgaccgtaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  MAL2   cloning  
• Gene symbol
  MAL2, MAL2-AS1
• Short name
  MAL2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  mal, T-cell differentiation protein, T-cell differentiation protein 2 (gene/pseudogene) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  mal, T-cell differentiation protein 2 (gene/pseudogene), MAL2 and IDBG-33761 and ENSG00000147676 and 114569, protein binding, Plasma membranes, Mal2 and IDBG-140574 and ENSMUSG00000024479 and 105853, MAL2 and IDBG-644869 and ENSBTAG00000011779 and 511940

Gene info

• Identity
  HGNC:13634
• Gene
  MAL2
• Long gene name
  mal, T cell differentiation protein 2
• Synonyms gene name
  • mal, T-cell differentiation protein 2 (gene/pseudogene)
  • mal, T cell differentiation protein 2 (gene/pseudogene)
• Synonyms name
  • MAL proteolipid protein 2
  • myelin and lymphocyte protein 2
• GenBank acession
  • AL117612
• Locus
  8q24.12
• Discovery year
  2001-09-05
• Entrez gene record
  114569
• Pubmed identfication
  • 11549320
  • 12370246
• RefSeq identity
  • NM_052886
• Classification
  • MARVEL domain containing

Gene info

• Identity
  HGNC:53626
• Gene
  MAL2-AS1
• Long gene name
  MAL2 antisense RNA 1
• Locus
  8q24.12
• Discovery year
  2017-08-03
• Entrez gene record
  105375726
• Classification
  • Antisense RNAs

Similar products