CXCR4 cloning plasmid

  • Catalog number
    CSB-CL006254HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the CXCR4 gene.
  • Specifications
    Gene name: CXCR4; Gene ID: 7852; Accession number: BC020968; Vector: pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1059; Sequence: atggaggggatcagtatatacacttcagataactacaccgaggaaatgggctcaggggactatgactccatgaaggaaccctgtttccgtgaagaaaatgctaatttcaataaaatcttcctgcccaccatctactccatcatcttcttaactggcattgtgggcaatggattggtcatcctggtcatgggttaccagaagaaactgagaagcatgacggacaagtacaggctgcacctgtcagtggccgacctcctctttgtcatcacgcttcccttctgggcagttgatgccgtggcaaactggtactttgggaacttcctatgcaaggcagtccatgtcatctacacagtcaacctctacagcagtgtcctcatcctggccttcatcagtctggaccgctacctggccatcgtccacgccaccaacagtcagaggccaaggaagctgttggctgaaaaggtggtctatgttggcgtctggatccctgccctcctgctgactattcccgacttcatctttgccaacgtcagtgaggcagatgacagatatatctgtgaccgcttctaccccaatgacttgtgggtggttgtgttccagtttcagcacatcatggttggccttatcctgcctggtattgtcatcctgtcctgctattgcattatcatctccaagctgtcacactccaagggccaccagaagcgcaaggccctcaagaccacagtcatcctcatcctggctttcttcgcctgttggctgccttactacattgggatcagcatcgactccttcatcctcctggaaatcatcaagcaagggtgtgagtttgagaacactgtgcacaagtggatttccatcaccgaggccctagctttcttccactgttgtctgaaccccatcctctatgctttccttggagccaaatttaaaacctctgcccagcacgcactcacctctgtgagcagagggtccagcctcaagatcctctccaaaggaaagcgaggtggacattcatctgtttccactgagtctgagtcttcaagttttcactccagctaa
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    CXCR4   cloning  
  • Gene symbol
    CXCR4
  • Short name
    CXCR4 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    chemokine (C-X-C motif) receptor 4 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    chemokine (C-X-C motif) receptor 4, CD184 and D2S201E and FB22 and HM89 and HSY3RR and LAP-3 and LAP3 and LCR1 and LESTR and NPY3R and NPYR and NPYRL and NPYY3R and WHIM, CXCR4 and IDBG-71032 and ENSG00000121966 and 7852, ubiquitin binding, Cell surfaces, Cxcr4 and IDBG-189999 and ENSMUSG00000045382 and 12767, CXCR4 and IDBG-642187 and ENSBTAG00000001060 and 281736
Gene info
Product images
Similar products
Filters
Contact
Chat with gentaur.com employee