CXCR4 cloning plasmid
-
Catalog numberCSB-CL006254HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CXCR4 gene.
-
SpecificationsGene name: CXCR4; Gene ID: 7852; Accession number: BC020968; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 1059; Sequence: atggaggggatcagtatatacacttcagataactacaccgaggaaatgggctcaggggactatgactccatgaaggaaccctgtttccgtgaagaaaatgctaatttcaataaaatcttcctgcccaccatctactccatcatcttcttaactggcattgtgggcaatggattggtcatcctggtcatgggttaccagaagaaactgagaagcatgacggacaagtacaggctgcacctgtcagtggccgacctcctctttgtcatcacgcttcccttctgggcagttgatgccgtggcaaactggtactttgggaacttcctatgcaaggcagtccatgtcatctacacagtcaacctctacagcagtgtcctcatcctggccttcatcagtctggaccgctacctggccatcgtccacgccaccaacagtcagaggccaaggaagctgttggctgaaaaggtggtctatgttggcgtctggatccctgccctcctgctgactattcccgacttcatctttgccaacgtcagtgaggcagatgacagatatatctgtgaccgcttctaccccaatgacttgtgggtggttgtgttccagtttcagcacatcatggttggccttatcctgcctggtattgtcatcctgtcctgctattgcattatcatctccaagctgtcacactccaagggccaccagaagcgcaaggccctcaagaccacagtcatcctcatcctggctttcttcgcctgttggctgccttactacattgggatcagcatcgactccttcatcctcctggaaatcatcaagcaagggtgtgagtttgagaacactgtgcacaagtggatttccatcaccgaggccctagctttcttccactgttgtctgaaccccatcctctatgctttccttggagccaaatttaaaacctctgcccagcacgcactcacctctgtgagcagagggtccagcctcaagatcctctccaaaggaaagcgaggtggacattcatctgtttccactgagtctgagtcttcaagttttcactccagctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCXCR4
-
Short nameCXCR4 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine (C-X-C motif) receptor 4 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetchemokine (C-X-C motif) receptor 4, CD184 and D2S201E and FB22 and HM89 and HSY3RR and LAP-3 and LAP3 and LCR1 and LESTR and NPY3R and NPYR and NPYRL and NPYY3R and WHIM, CXCR4 and IDBG-71032 and ENSG00000121966 and 7852, ubiquitin binding, Cell surfaces, Cxcr4 and IDBG-189999 and ENSMUSG00000045382 and 12767, CXCR4 and IDBG-642187 and ENSBTAG00000001060 and 281736
-
Gene info
-
Identity
-
Gene
-
Long gene nameC-X-C motif chemokine receptor 4
-
Synonyms gene name
- chemokine (C-X-C motif), receptor 4 (fusin)
- chemokine (C-X-C motif) receptor 4
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-09-17
-
Entrez gene record
-
Pubmed identfication
-
Classification
- C-X-C motif chemokine receptors
- CD molecules
-
VEGA ID
-
Locus Specific Databases