BCL6B cloning plasmid

  • Catalog number
    CSB-CL818679HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the BCL6B gene.
  • Specifications
    Gene name: BCL6B; Gene ID: 255877; Accession number: BC059404; Vector: pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1443; Sequence: atgggttcccccgccgccccggagggagcgctgggctacgtccgcgagttcactcgccactcctccgacgtgctgggcaacctcaacgagctgcgcctgcgcgggatcctcactgacgtcacgctgctggttggcgggcaacccctcagagcacacaaggcagttctcatcgcctgcagtggcttcttctattcaattttccggggccgtgcgggagtcggggtggacgtgctctctctgcccgggggtcccgaagcgagaggcttcgcccctctattggacttcatgtacacttcgcgcctgcgcctctctccagccactgcaccagcagtcctagcggccgccacctatttgcagatggagcacgtggtccaggcatgccaccgcttcatccaggccagctatgaacctctgggcatctccctgcgccccctggaagcagaacccccaacacccccaacggcccctccaccaggtagtcccaggcgctccgaaggacacccagacccacctactgaatctcgaagctgcagtcaaggcccccccagtccagccagccctgaccccaaggcctgcaactggaaaaagtacaagtacatcgtgctaaactctcaggcctcccaagcagggagcctggtcggggagagaagttctggtcaaccttgcccccaagccaggctccccagtggagacgaggcctccagcagcagcagcagcagcagcagcagcagcagtgaagaaggacccattcctggtccccagagcaggctctctccaactgctgccactgtgcagttcaaatgtggggctccagccagtaccccctacctcctcacatcccaggctcaagacacctctggatcaccctctgaacgggctcgtccactaccgggaagtgaatttttcagctgccagaactctgaggctgtggcagggtgctcatcggggctggactccttggttcctggggacgaagacaaaccctataagtgtcagctgtgccggtcttcgttccgctacaagggcaaccttgccagtcaccgtacagtgcacacaggggaaaagccttaccactgctcaatctgcggagcccgttttaaccggccagcaaacctgaaaacgcacagccgcatccattcgggagagaagccgtataagtgtgagacgtgcggctcgcgctttgtacaggtggcacatctgcgggcgcacgtgctgatccacaccggggagaagccctacccttgccctacctgcggaacccgcttccgccacctgcagaccctcaagagccacgttcgcatccacaccggagagaagccttaccactgcgacccctgtggcctgcatttccggcacaagagtcaactgcggctgcatctgcgccagaaacacggagctgctaccaacaccaaagtgcactaccacattctcggggggccctag
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    BCL6B   cloning  
  • Gene symbol
    BCL6B
  • Short name
    BCL6B cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    B-cellular CLL/lymphoma 6, member B cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    B-cell CLL/lymphoma 6, member B, BCL6B and IDBG-23013 and ENSG00000161940 and 255877, metal ion binding, nuclei, Bcl6b and IDBG-193813 and ENSMUSG00000000317 and 12029, BCL6B and IDBG-634506 and ENSBTAG00000020854 and 100138731
Gene info
  • Identity
  • Gene
  • Long gene name
    BCL6B transcription repressor
  • Synonyms gene
  • Synonyms gene name
    • zinc finger protein 62
    • B-cell CLL/lymphoma 6, member B (zinc finger protein)
    • B-cell CLL/lymphoma 6, member B
    • B cell CLL/lymphoma 6B
    • BCL6B, transcription repressor
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2000-01-20
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • BTB domain containing
    • Zinc fingers C2H2-type
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee