IL1B cloning plasmid
-
Catalog numberCSB-CL011614HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the IL1B gene.
-
SpecificationsGene name: IL1B; Gene ID: 3553; Accession number: BC008678; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 810; Sequence: atggcagaagtacctgagctcgccagtgaaatgatggcttattacagtggcaatgaggatgacttgttctttgaagctgatggccctaaacagatgaagtgctccttccaggacctggacctctgccctctggatggcggcatccagctacgaatctccgaccaccactacagcaagggcttcaggcaggccgcgtcagttgttgtggccatggacaagctgaggaagatgctggttccctgcccacagaccttccaggagaatgacctgagcaccttctttcccttcatctttgaagaagaacctatcttcttcgacacatgggataacgaggcttatgtgcacgatgcacctgtacgatcactgaactgcacgctccgggactcacagcaaaaaagcttggtgatgtctggtccatatgaactgaaagctctccacctccagggacaggatatggagcaacaagtggtgttctccatgtcctttgtacaaggagaagaaagtaatgacaaaatacctgtggccttgggcctcaaggaaaagaatctgtacctgtcctgcgtgttgaaagatgataagcccactctacagctggagagtgtagatcccaaaaattacccaaagaagaagatggaaaagcgatttgtcttcaacaagatagaaatcaataacaagctggaatttgagtctgcccagttccccaactggtacatcagcacctctcaagcagaaaacatgcccgtcttcctgggagggaccaaaggcggccaggatataactgacttcaccatgcaatttgtgtcttcctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolIL1B
-
Short nameIL1B cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameinterleukin 1, beta cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetinterleukin 1, beta, IL-1 and IL1-BETA and IL1F2, IL1B and IDBG-66519 and ENSG00000125538 and 3553, protein domain specific binding, Extracellular, Il1b and IDBG-205936 and ENSMUSG00000027398 and 16176, IL1B and IDBG-634613 and ENSBTAG00000001321 and 281251
-
Gene info
-
Identity
-
Gene
-
Long gene nameinterleukin 1 beta
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1989-03-31
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Interleukins
-
VEGA ID