CXCL10 cloning plasmid

• Catalog number
  CSB-CL006240HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CXCL10 gene.
• Specifications
  Gene name: CXCL10; Gene ID: 3627; Accession number: BC010954; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 297; Sequence: atgaatcaaactgccattctgatttgctgccttatctttctgactctaagtggcattcaaggagtacctctctctagaactgtacgctgtacctgcatcagcattagtaatcaacctgttaatccaaggtctttagaaaaacttgaaattattcctgcaagccaattttgtccacgtgttgagatcattgctacaatgaaaaagaagggtgagaagagatgtctgaatccagaatcgaaggccatcaagaatttactgaaagcagttagcaaggaaaggtctaaaagatctccttaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CXCL10   cloning  
• Gene symbol
  CXCL10
• Short name
  CXCL10 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  chemokine (C-X-C motif) ligand 10 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  chemokine (C-X-C motif) ligand 10, C7 and crg-2 and gIP-10 and IFI10 and INP10 and IP-10 and mob-1 and SCYB10, CXCL10 and IDBG-25212 and ENSG00000169245 and 3627, CXCR3 chemokine receptor binding, Extracellular, Cxcl10 and IDBG-179916 and ENSMUSG00000034855 and 15945, CXCL10 and IDBG-643109 and ENSBTAG00000001725 and 615107

Gene info

• Identity
  HGNC:10637
• Gene
  CXCL10
• Long gene name
  C-X-C motif chemokine ligand 10
• Synonyms gene
  • INP10
  • SCYB10
• Synonyms gene name
  • small inducible cytokine subfamily B (Cys-X-Cys), member 10
  • chemokine (C-X-C motif) ligand 10
• Synonyms
  • IFI10
  • IP-10
  • crg-2
  • mob-1
  • C7
  • gIP-10
• GenBank acession
  • X02530
• Locus
  4q21.1
• Discovery year
  1999-12-09
• Entrez gene record
  3627
• Pubmed identfication
  • 2437586
  • 3925348
• Classification
  • Chemokine ligands
• VEGA ID
  OTTHUMG00000160887

Similar products