CXCL10 cloning plasmid
-
Catalog numberCSB-CL006240HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CXCL10 gene.
-
SpecificationsGene name: CXCL10; Gene ID: 3627; Accession number: BC010954; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 297; Sequence: atgaatcaaactgccattctgatttgctgccttatctttctgactctaagtggcattcaaggagtacctctctctagaactgtacgctgtacctgcatcagcattagtaatcaacctgttaatccaaggtctttagaaaaacttgaaattattcctgcaagccaattttgtccacgtgttgagatcattgctacaatgaaaaagaagggtgagaagagatgtctgaatccagaatcgaaggccatcaagaatttactgaaagcagttagcaaggaaaggtctaaaagatctccttaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCXCL10
-
Short nameCXCL10 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine (C-X-C motif) ligand 10 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetchemokine (C-X-C motif) ligand 10, C7 and crg-2 and gIP-10 and IFI10 and INP10 and IP-10 and mob-1 and SCYB10, CXCL10 and IDBG-25212 and ENSG00000169245 and 3627, CXCR3 chemokine receptor binding, Extracellular, Cxcl10 and IDBG-179916 and ENSMUSG00000034855 and 15945, CXCL10 and IDBG-643109 and ENSBTAG00000001725 and 615107
-
Gene info
-
Identity
-
Gene
-
Long gene nameC-X-C motif chemokine ligand 10
-
Synonyms gene
-
Synonyms gene name
- small inducible cytokine subfamily B (Cys-X-Cys), member 10
- chemokine (C-X-C motif) ligand 10
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1999-12-09
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Chemokine ligands
-
VEGA ID