ARHGDIG cloning plasmid
-
Catalog numberCSB-CL858727HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ARHGDIG gene.
-
SpecificationsGene name: ARHGDIG; Gene ID: 398; Accession number: BC047699; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 678; Sequence: atgctgggcctggacgcgtgcgagctgggggcgcagctgctggagctgctccggctggcgctgtgcgcccgagtcctcctggctgacaaggagggtgggccgccggcagtggacgaggtgttggatgaggctgtgcccgagtaccgggcgccggggaggaagagcctcttggagatccggcagctggacccggacgacaggagcctggccaagtacaagcgggtgctgctggggcccctgccaccggccgtggacccaagcctgcccaatgtgcaggtgaccaggctgacactcctgtcggaacaggctccggggcccgtcgtcatggatctcacaggggacctggctgttctgaaggaccaggtgtttgtcctgaaggaaggtgttgattacagagtgaagatctccttcaaggtccacagggagattgtcagcggcctcaagtgtctgcaccacacctaccgccggggcctgcgcgtggacaagaccgtctacatggtgggcagctatggcccgagcgcccaggagtatgagtttgtgactccggtggaggaagcgccgaggggtgcgctggtgcggggcccctatctggtggtgtccctcttcaccgacgatgacaggacgcaccacctgtcctgggagtggggtctctgcatctgccaggactggaaggactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolARHGDIG
-
Short nameARHGDIG cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameRho GDP dissociation inhibitor (GDI) g cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetRho GDP dissociation inhibitor (GDI) gamma, RHOGDI-3, ARHGDIG and IDBG-402162 and ENSG00000242173 and 398, protein binding, Plasma membranes, Arhgdig and IDBG-154871 and ENSMUSG00000073433 and 14570, BT.24416 and IDBG-633653 and ENSBTAG00000027854 and 613745
-
Gene info
-
Identity
-
Gene
-
Long gene nameRho GDP dissociation inhibitor gamma
-
Synonyms gene name
- Rho GDP dissociation inhibitor (GDI) gamma
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1997-07-11
-
Entrez gene record
-
Pubmed identfication
-
VEGA ID