MALL cloning plasmid

• Catalog number
  CSB-CL619748HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the MALL gene.
• Specifications
  Gene name: MALL; Gene ID: 7851; Accession number: BC003179; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 462; Sequence: atggcctcgcccgacccgcccgccaccagctacgccccgtccgacgtgccctcgggggtcgcgctgttcctcaccatccctttcgccttcttcctgcccgagctgatatttgggttcttggtctggaccatggtagccgccacccacatagtataccccttgctgcaaggatgggtgatgtatgtctcgctcacctcgtttctcatctccttgatgttcctgttgtcttacttgtttggattttacaaaagatttgaatcctggagagttctggacagcctgtaccacgggaccactggcatcctgtacatgagcgctgccgtcctacaagtacatgccacgattgtttctgagaaactgctggacccaagaatttactacattaattcggcagcctcgttcttcgccttcatcgccacgctgctctacattctccatgccttcagcatctattaccactga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  MALL   cloning  
• Gene symbol
  MALL
• Short name
  MALL cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  mal, T-cell differentiation protein, T-cell differentiation protein-like cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  mal, T-cell differentiation protein-like, BENE, MALL and IDBG-65460 and ENSG00000144063 and 7851, protein binding, Plasma membranes, Mall and IDBG-205068 and ENSMUSG00000027377 and 228576, MALL and IDBG-629052 and ENSBTAG00000024091 and 512289

Gene info

• Identity
  HGNC:6818
• Gene
  MALL
• Long gene name
  mal, T cell differentiation protein like
• Synonyms gene name
  • mal, T-cell differentiation protein like
• Synonyms
  • BENE
• GenBank acession
  • U17077
• Locus
  2q13
• Discovery year
  1997-10-08
• Entrez gene record
  7851
• Pubmed identfication
  • 9326933
• RefSeq identity
  • NM_005434
• Classification
  • MARVEL domain containing
  • MicroRNA protein coding host genes
• VEGA ID
  OTTHUMG00000131196

Similar products