FSTL1 cloning plasmid
-
Catalog numberCSB-CL613266HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the FSTL1 gene.
-
SpecificationsGene name: FSTL1; Gene ID: 11167; Accession number: BC000055; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 927; Sequence: atgtggaaacgctggctcgcgctcgcgctcgcgctggtggcggtcgcctgggtccgcgccgaggaagagctaaggagcaaatccaagatctgtgccaatgtgttttgtggagccggccgggaatgtgcagtcacagagaaaggggaacccacctgtctctgcattgagcaatgcaaacctcacaagaggcctgtgtgtggcagtaatggcaagacctacctcaaccactgtgaactgcatcgagatgcctgcctcactggatccaaaatccaggttgattacgatggacactgcaaagagaagaaatccgtaagtccatctgccagcccagttgtttgctatcagtccaaccgtgatgagctccgacgtcgcatcatccagtggctggaagctgagatcattccagatggctggttctctaaaggcagcaactacagtgaaatcctagacaagtattttaagaactttgataatggtgattctcgcctggactccagtgaattcctgaagtttgtggaacagaatgaaactgccatcaatattacaacgtatccagaccaggagaacaacaagttgcttaggggactctgtgttgatgctctcattgaactgtctgatgaaaatgctgattggaaactcagcttccaagagtttctcaagtgcctcaacccatctttcaaccctcctgagaagaagtgtgccctggaggatgaaacgtatgcagatggagctgagaccgaggtggactgtaaccgctgtgtctgtgcctgtggaaattgggtctgtacagccatgacctgtgacggaaagaatcagaagggggcccagacccagacagaggaggagatgaccagatatgtccaggagctccaaaagcatcaggaaacagctgaaaagaccaagagagtgagcaccaaagagatctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolFSTL1
-
Short nameFSTL1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namefollistatin-like 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetfollistatin-like 1, FRP and FSL1 and MIR198, FSTL1 and IDBG-51777 and ENSG00000163430 and 11167, heparin binding, Extracellular, Fstl1 and IDBG-159696 and ENSMUSG00000022816 and 14314, FSTL1 and IDBG-632865 and ENSBTAG00000022155 and 101909195,534482
-
Gene info
-
Identity
-
Gene
-
Long gene namefollistatin like 1
-
Synonyms gene name
- follistatin-like 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1999-09-07
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- MicroRNA protein coding host genes
- SPARC family
-
VEGA ID