ICAM2 cloning plasmid

  • Catalog number
    CSB-CL010950HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the ICAM2 gene.
  • Specifications
    Gene name: ICAM2; Gene ID: 3384; Accession number: BC003097; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 828; Sequence: atgtcctctttcggttacaggaccctgactgtggccctcttcaccctgatctgctgtccaggatcggatgagaaggtattcgaggtacacgtgaggccaaagaagctggcggttgagcccaaagggtccctcgaggtcaactgcagcaccacctgtaaccagcctgaagtgggtggtctggagacctctctagataagattctgctggacgaacaggctcagtggaaacattacttggtctcaaacatctcccatgacacggtcctccaatgccacttcacctgctccgggaagcaggagtcaatgaattccaacgtcagcgtgtaccagcctccaaggcaggtcatcctgacactgcaacccactttggtggctgtgggcaagtccttcaccattgagtgcagggtgcccaccgtggagcccctggacagcctcaccctcttcctgttccgtggcaatgagactctgcactatgagaccttcgggaaggcagcccctgctccgcaggaggccacagccacattcaacagcacggctgacagagaggatggccaccgcaacttctcctgcctggctgtgctggacttgatgtctcgcggtggcaacatctttcacaaacactcagccccgaagatgttggagatctatgagcctgtgtcggacagccagatggtcatcatagtcacggtggtgtcggtgttgctgtccctgttcgtgacatctgtcctgctctgcttcatcttcggccagcacttgcgccagcagcggatgggcacctacggggtgcgagcggcttggaggaggctgccccaggccttccggccatag
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    ICAM2   cloning  
  • Gene symbol
    ICAM2
  • Short name
    ICAM2 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    intercellular adhesion molecule 2 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    intercellular adhesion molecule 2, CD102, ICAM2 and IDBG-64502 and ENSG00000108622 and 3384, protein binding, Plasma membranes, Icam2 and IDBG-213473 and ENSMUSG00000001029 and 15896, ICAM2 and IDBG-641832 and ENSBTAG00000019432 and 616254
Gene info
  • Identity
  • Gene
  • Long gene name
    intercellular adhesion molecule 2
  • Synonyms
  • Locus
  • Discovery year
    1990-03-06
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • CD molecules
    • Ig-like cell adhesion molecule family
    • Immunoglobulin like domain containing
    • Receptor ligands
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee