PRDX3 cloning plasmid

• Catalog number
  CSB-CL018656HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the PRDX3 gene.
• Specifications
  Gene name: PRDX3; Gene ID: 10935; Accession number: BC008435; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 771; Sequence: atggcggctgctgtaggacggttgctccgagcgtcggttgcccgacatgtgagtgccattccttggggcatttctgccactgcagccctctggcctgctgcatgtggaagaacgagcttgacaaatttattgtgttctggttccagtcaagcaaaattattcagcaccagttcctcatgccatgcacctgctgtcacccagcatgcaccctattttaagggtacagccgttgtcaatggagagttcaaagacctaagccttgatgactttaaggggaaatatttggtgcttttcttctatcctttggatttcacctttgtgtgtcctacagaaattgttgcttttagtgacaaagctaacgaatttcacgatgtgaactgtgaagttgtcgcagtctcagtggattcccactttagccatcttgcctggataaatacaccaagaaagaatggtggtttgggccacatgaacatcgcactcttgtcagacttaactaagcagatttcccgagactacggtgtgctgttagaaggttctggtcttgcactaagaggtctcttcataattgaccccaatggagtcatcaagcatttgagcgtcaacgatctcccagtgggccgaagcgtggaagaaaccctccgcttggtgaaggcgttccagtatgtagaaacacatggagaagtctgcccagcgaactggacaccggattctcctacgatcaagccaagtccagctgcttccaaagagtactttcagaaggtaaatcagtag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  PRDX3   cloning  
• Gene symbol
  PRDX3
• Short name
  PRDX3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  peroxiredoxin 3 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  peroxiredoxin 3, AOP-1 and AOP1 and HBC189 and MER5 and PRO1748 and prx-III and SP-22, PRDX3 and IDBG-91076 and ENSG00000165672 and 10935, peroxiredoxin activity, Cytoplasm, Prdx3 and IDBG-181859 and ENSMUSG00000024997 and 11757, PRDX3 and IDBG-640354 and ENSBTAG00000008731 and 281998

Gene info

• Identity
  HGNC:9354
• Gene
  PRDX3
• Long gene name
  peroxiredoxin 3
• Synonyms gene
  • AOP1
• Synonyms gene name
  • antioxidant protein 1
• Synonyms
  • MER5
  • AOP-1
  • SP-22
• GenBank acession
  • D49396
• Locus
  10q26.11
• Discovery year
  1999-08-12
• Entrez gene record
  10935
• Pubmed identfication
  • 7733872
  • 9363753
• RefSeq identity
  • NM_006793
• Classification
  • Peroxiredoxins
• VEGA ID
  OTTHUMG00000019146

Similar products