PSMB2 cloning plasmid
-
Catalog numberCSB-CL018879HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PSMB2 gene.
-
SpecificationsGene name: PSMB2; Gene ID: 5690; Accession number: BC000268; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 606; Sequence: atggagtacctcatcggtatccaaggccccgactatgttcttgtcgcctccgaccgggtggccgccagcaatattgtccagatgaaggacgatcatgacaagatgtttaagatgagtgaaaagatattactcctgtgtgttggagaggctggagacactgtacagtttgcagaatatattcagaaaaacgtgcaactttataagatgcgaaatggatatgaattgtctcccacggcagcagctaacttcacacgccgaaacctggctgactgtcttcggagtcggaccccatatcatgtgaacctcctcctggctggctatgatgagcatgaagggccagcgctgtattacatggactacctggcagccttggccaaggccccttttgcagcccacggctatggtgccttcctgactctcagtatcctcgaccgatactacacaccgactatctcacgtgagagggcagtggaactccttaggaaatgtctggaggagctccagaaacgcttcatcctgaatctgccaaccttcagtgttcgaatcattgacaaaaatggcatccatgacctggataacatttccttccccaaacagggctcctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPSMB2
-
Short namePSMB2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameproteasome (prosome, macropain) subunit, b classification, 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetproteasome (prosome, macropain) subunit, beta type, 2, HC7-I, PSMB2 and IDBG-96209 and ENSG00000126067 and 5690, protein binding, nuclei, Psmb2 and IDBG-189115 and ENSMUSG00000028837 and 26445, PSMB2 and IDBG-641505 and ENSBTAG00000002377 and 516919
-
Gene info
-
Identity
-
Gene
-
Long gene nameproteasome 20S subunit beta 2
-
Synonyms gene name
- proteasome (prosome, macropain) subunit, beta type, 2
- proteasome subunit beta 2
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1995-05-03
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Proteasome
-
VEGA ID