TNFSF13 cloning plasmid
-
Catalog numberCSB-CL023989HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TNFSF13 gene.
-
SpecificationsGene name: TNFSF13; Gene ID: 8741; Accession number: BC008042; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 744; Sequence: atgccagcctcatctcctttcttgctagcccccaaagggcctccaggcaacatggggggcccagtcagagagccggcactctcagttgccctctggttgagttggggggcagctctgggggccgtggcttgtgccatggctctgctgacccaacaaacagagctgcagagcctcaggagagaggtgagccggctgcaggggacaggaggcccctcccagaatggggaagggtatccctggcagagtctcccggagcagagttccgatgccctggaagcctgggagagtggggagagatcccggaaaaggagagcagtgctcacccaaaaacagaagaagcagcactctgtcctgcacctggttcccattaacgccacctccaaggatgactccgatgtgacagaggtgatgtggcaaccagctcttaggcgtgggagaggcctacaggcccaaggatatggtgtccgaatccaggatgctggagtttatctgctgtatagccaggtcctgtttcaagacgtgactttcaccatgggtcaggtggtgtctcgagaaggccaaggaaggcaggagactctattccgatgtataagaagtatgccctcccacccggaccgggcctacaacagctgctatagcgcaggtgtcttccatttacaccaaggggatattctgagtgtcataattccccgggcaagggcgaaacttaacctctctccacatggaaccttcctgggactttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTNFSF13, TNFSF12-TNFSF13
-
Short nameTNFSF13 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametumor necrosis factor (ligand) superfamily, member 13 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettumor necrosis factor (ligand) superfamily, member 13, APRIL and CD256 and TALL-2 and TALL2 and TRDL-1 and ZTNF2, TNFSF13 and IDBG-25388 and ENSG00000161955 and 8741, protein binding, nuclei, Tnfsf13 and IDBG-488114 and ENSMUSG00000089669 and 69583, TNFSF13 and IDBG-635008 and ENSBTAG00000000130 and 100551513,538567
-
Gene info
-
Identity
-
Gene
-
Long gene nameTNF superfamily member 13
-
Synonyms gene name
- tumor necrosis factor (ligand) superfamily, member 13
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-12-04
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Tumor necrosis factor superfamily
- CD molecules
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameTNFSF12-TNFSF13 readthrough
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2007-07-31
-
Entrez gene record
-
Pubmed identfication
-
VEGA ID