MZF1 cloning plasmid
-
Catalog numberCSB-CL015389HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the MZF1 gene.
-
SpecificationsGene name: MZF1; Gene ID: 7593; Accession number: BC053316; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 873; Sequence: atgaggcctgcggtgctgggctccccagaccgagcacccccagaagatgaggggcctgtcatggtgaagctagaggactctgaggaggagggtgaggctgccttatgggacccaggccctgaagctgcacgcctgcgtttccggtgcttccactatgaggaggccacagggccccaagaggccctggcccagctccgagagctgtgtcgccagtggctgcgtccagaggtacgctccaaggagcagatgctggagctgttggtgctggagcagttcctgggcgcactgccccctgagatccaggcccgtgtgcaggggcagcggccaggcagccccgaggaggctgctgccctagtagatgggctgcgccgggagccgggcggaccccggagatgggtcacagtccaggtgcagggccaggaggtcctatcagagaagatggagccctccagtttccagcccctacctgaaactgagcctccaactccagagcctgggcccaagacacctcctaggactatgcaggaatcaccactgggcctgcaggtgaaagaggagtcagaggttacagaggactcagatttcctggagtctgggcctctagctgccacccaggagtctgtacccaccctcctgcctgaggaggcccagagatgtgggaccgtgctggaccagatctttccccacagcaagactgggcctgagggtccctcatggagggagcaccccagggccctgtggcatgaggaagctgggggcatcttctccccaggggccggagccggggccgccccagcactgggggcggggtggttaggggcggccgttgcgatgtatgtggcaaggtgttcagccaacgcagcaacctgctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolMZF1-AS1, MZF1
-
Short nameMZF1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namemyeloid zinc finger 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetmyeloid zinc finger 1, MZF-1 and MZF1B and ZFP98 and ZNF42 and ZSCAN6, MZF1 and IDBG-73544 and ENSG00000099326 and 7593, metal ion binding, nuclei, Mzf1 and IDBG-144201 and ENSMUSG00000030380 and 109889, MZF1 and IDBG-642575 and ENSBTAG00000037581 and 523865
-
Gene info
-
Identity
-
Gene
-
Long gene nameMZF1 antisense RNA 1
-
GenBank acession
-
Locus
-
Discovery year2014-08-22
-
Entrez gene record
-
RefSeq identity
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namemyeloid zinc finger 1
-
Synonyms gene
-
Synonyms gene name
- zinc finger protein 42 (myeloid-specific retinoic acid-responsive)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1990-11-05
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- SCAN domain containing
- Zinc fingers C2H2-type
-
VEGA ID