MLLT10 cloning plasmid

• Catalog number
  CSB-CL014632HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the MLLT10 gene.
• Specifications
  Gene name: MLLT10; Gene ID: 8028; Accession number: BC080577; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 381; Sequence: atggtctctagcgaccggcccgtgtcactggaggacgaggtctcccatagtatgaaggagatgattggaggctgttgcgtttgctcagacgagagaggctgggccgagaacccgctggtttattgcgacgggcacggctgcagcgtcgcggtgcatcaagcttgctatggcattgttcaagtacccactggaccgtggttttgcaggaaatgtgaatctcaggagagagcagccagagtggcagagtctcgctctgttgcccaggctaaagtgcagtggtgtgatctcagcccactgcaacctctgctccccgggttcaagcgattctcctgcctcagcctcccaaatggtatgcaattcctgttggttagcctcatctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  MLLT10   cloning  
• Gene symbol
  MLLT10
• Short name
  MLLT10 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  myeloid/lymphoid and mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10, AF10, MLLT10 and IDBG-60813 and ENSG00000078403 and 8028, zinc ion binding, nuclei, Mllt10 and IDBG-139346 and ENSMUSG00000026743 and 17354, MLLT10 and IDBG-637510 and ENSBTAG00000044074 and 519864

Gene info

• Identity
  HGNC:16063
• Gene
  MLLT10
• Long gene name
  MLLT10 histone lysine methyltransferase DOT1L cofactor
• Synonyms gene name
  • myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10
  • myeloid/lymphoid or mixed-lineage leukemia; translocated to, 10
• Synonyms
  • AF10
• GenBank acession
  • U13948
• Locus
  10p12.31
• Discovery year
  2001-07-16
• Entrez gene record
  8028
• Pubmed identfication
  • 7888665
  • 26439302
• Classification
  • PHD finger proteins
• VEGA ID
  OTTHUMG00000017799

Similar products