HSPB1 cloning plasmid
-
Catalog numberCSB-CL010833HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the HSPB1 gene.
-
SpecificationsGene name: HSPB1; Gene ID: 3315; Accession number: BC012292; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 618; Sequence: atgaccgagcgccgcgtccccttctcgctcctgcggggccccagctgggaccccttccgcgactggtacccgcatagccgcctcttcgaccaggccttcgggctgccccggctgccggaggagtggtcgcagtggttaggcggcagcagctggccaggctacgtgcgccccctgccccccgccgccatcgagagccccgcagtggccgcgcccgcctacagccgcgcgctcagccggcaactcagcagcggggtctcggagatccggcacactgcggaccgctggcgcgtgtccctggatgtcaaccacttcgccccggacgagcggacggtcaagaccaaggatggcgtggtggagatctccggcaagcacgaggagttgcaggacgagcatggctacatctcccggtgcttcacgcggaaatacacgctgccccccggtgtggaccccacccaagtttcctcctccctgtcccctgagggcacactgaccgtggaggcccccatgcccaagctagccacgcagtccaacgagatcaccatcccagtcaccttcgagtcgcgggcccagcttgggggcccagaagctgcaaaatccgatgagactgccgccaagtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolHSPB1
-
Short nameHSPB1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameheat shock 27kDa protein 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetheat shock 27kDa protein 1, CMT2F and HEL-S-102 and HMN2B and HS.76067 and Hsp25 and HSP27 and HSP28 and SRP27, HSPB1 and IDBG-23058 and ENSG00000106211 and 3315, poly(A) RNA binding, nuclei, Hspb1 and IDBG-204151 and ENSMUSG00000004951 and 15507, HSPB1 and IDBG-640144 and ENSBTAG00000011969 and 516099
-
Gene info
-
Identity
-
Gene
-
Long gene nameheat shock protein family B (small) member 1
-
Synonyms gene name
- heat shock 27kD protein 1
- heat shock 27kDa protein 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1991-07-09
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Small heat shock proteins
-
VEGA ID
-
Locus Specific Databases