COL20A1 cloning plasmid

• Catalog number
  CSB-CL873727HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the COL20A1 gene.
• Specifications
  Gene name: COL20A1; Gene ID: 57642; Accession number: BC019637; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 468; Sequence: atgagaggcctggagggaactgctggcctgcctggaccccctggccccagggggttccagggcatggcaggggccaggggcactagtggagagcgaggacctccagggaccgtggggcccacaggactgccagggcccaaaggggaacgaggagagaagggcgagccgcagtcccttgccaccctctaccagcttgtgagccaggcctgtgagtctgccattcagacacacgtgtcaaagttcgactccttccacgagaacaccaggccccccatgcccatcttggagcagaagctggagccgggcactgagcccctggggtcccctggcacccgcagcaaggccctggttcctggagaatgggggcgtggtggccgccaccttgagggcagaggggagcctggagctgttggtcagatgggcagccctgggcagcagggggctagcacccagggcctctgggagtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  COL20A1   cloning  
• Gene symbol
  COL20A1
• Short name
  COL20A1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  collagen, classification XX, a 1 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  collagen, type XX, alpha 1, COL20A1 and IDBG-85965 and ENSG00000101203 and 57642, protein binding, Extracellular, Col20a1 and IDBG-213939 and ENSMUSG00000016356 and 73368, COL20A1 and IDBG-640661 and ENSBTAG00000004582 and 519501

Gene info

• Identity
  HGNC:14670
• Gene
  COL20A1
• Long gene name
  collagen type XX alpha 1 chain
• Synonyms gene name
  • collagen, type XX, alpha 1
• Synonyms
  • KIAA1510
• GenBank acession
  • BC043183
• Locus
  20q13.33
• Discovery year
  2005-07-15
• Entrez gene record
  57642
• Pubmed identfication
  • 10819331
• RefSeq identity
  • NM_020882
• Classification
  • Fibronectin type III domain containing
  • Collagens
• VEGA ID
  OTTHUMG00000032964

Similar products