PRKRA cloning plasmid

  • Catalog number
    CSB-CL018717HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the PRKRA gene.
  • Specifications
    Gene name: PRKRA; Gene ID: 8575; Accession number: BC009470; Vector: pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 942; Sequence: atgtcccagagcaggcaccgcgccgaggccccgccgctggagcgcgaggacagtgggaccttcagtttggggaagatgataacagctaagccagggaaaacaccgattcaggtattacacgaatacggcatgaagaccaagaacatcccagtttatgaatgtgaaagatctgatgtgcaaatacacgtgcccactttcaccttcagagtaaccgttggtgacataacctgcacaggtgaaggtacaagtaagaagctggcgaaacatagagctgcagaggctgccataaacattttgaaagccaatgcaagtatttgctttgcagttcctgaccccttaatgcctgacccttccaagcaaccaaagaaccagcttaatcctattggttcattacaggaattggctattcatcatggctggagacttcctgaatataccctttcccaggagggaggacctgctcataagagagaatatactacaatttgcaggctagagtcatttatggaaactggaaagggggcatcaaaaaagcaagccaaaaggaatgctgctgagaaatttcttgccaaatttagtaatatttctccagagaaccacatttctttaacaaatgtagtaggacattctttaggatgtacttggcattccttgaggaattctcctggtgaaaagatcaacttactgaaaagaagcctccttagtattccaaatacagattacatccagctgcttagtgaaattgccaaggaacaaggttttaatataacatatttggatatagatgaactgagcgccaatggacaatatcaatgtcttgctgaactgtccaccagccccatcacagtctgtcatggctccggtatctcctgtggcaatgcacaaagtgatgcagctcacaatgctttgcagtatttaaagataatagcagaaagaaagtaa
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    PRKRA   cloning  
  • Gene symbol
    CHROMR, PRKRA
  • Short name
    PRKRA cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    protein kinase, interferon-inducible double stranded RNA dependent activator cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    protein kinase, interferon-inducible double stranded RNA dependent activator, DYT16 and PACT and RAX, PRKRA and IDBG-76030 and ENSG00000180228 and 8575, poly(A) RNA binding, Plasma membranes, Prkra and IDBG-182095 and ENSMUSG00000002731 and 23992, PRKRA and IDBG-640208 and ENSBTAG00000001096 and 282875
Gene info
Gene info
Similar products
Filters
Contact
Chat with gentaur.com employee