PRKRA cloning plasmid
-
Catalog numberCSB-CL018717HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PRKRA gene.
-
SpecificationsGene name: PRKRA; Gene ID: 8575; Accession number: BC009470; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 942; Sequence: atgtcccagagcaggcaccgcgccgaggccccgccgctggagcgcgaggacagtgggaccttcagtttggggaagatgataacagctaagccagggaaaacaccgattcaggtattacacgaatacggcatgaagaccaagaacatcccagtttatgaatgtgaaagatctgatgtgcaaatacacgtgcccactttcaccttcagagtaaccgttggtgacataacctgcacaggtgaaggtacaagtaagaagctggcgaaacatagagctgcagaggctgccataaacattttgaaagccaatgcaagtatttgctttgcagttcctgaccccttaatgcctgacccttccaagcaaccaaagaaccagcttaatcctattggttcattacaggaattggctattcatcatggctggagacttcctgaatataccctttcccaggagggaggacctgctcataagagagaatatactacaatttgcaggctagagtcatttatggaaactggaaagggggcatcaaaaaagcaagccaaaaggaatgctgctgagaaatttcttgccaaatttagtaatatttctccagagaaccacatttctttaacaaatgtagtaggacattctttaggatgtacttggcattccttgaggaattctcctggtgaaaagatcaacttactgaaaagaagcctccttagtattccaaatacagattacatccagctgcttagtgaaattgccaaggaacaaggttttaatataacatatttggatatagatgaactgagcgccaatggacaatatcaatgtcttgctgaactgtccaccagccccatcacagtctgtcatggctccggtatctcctgtggcaatgcacaaagtgatgcagctcacaatgctttgcagtatttaaagataatagcagaaagaaagtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCHROMR, PRKRA
-
Short namePRKRA cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameprotein kinase, interferon-inducible double stranded RNA dependent activator cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetprotein kinase, interferon-inducible double stranded RNA dependent activator, DYT16 and PACT and RAX, PRKRA and IDBG-76030 and ENSG00000180228 and 8575, poly(A) RNA binding, Plasma membranes, Prkra and IDBG-182095 and ENSMUSG00000002731 and 23992, PRKRA and IDBG-640208 and ENSBTAG00000001096 and 282875
-
Gene info
-
Identity
-
Gene
-
Long gene namecholesterol induced regulator of metabolism RNA
-
Synonyms gene
-
Synonyms gene name
- PRKRA antisense RNA 1
-
Synonyms
-
Synonyms name
-
Locus
-
Discovery year2018-09-27
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Long non-coding RNAs with non-systematic symbols
Gene info
-
Identity
-
Gene
-
Long gene nameprotein activator of interferon induced protein kinase EIF2AK2
-
Synonyms gene name
- protein kinase, interferon-inducible double stranded RNA dependent activator
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1999-12-07
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID