CCR4 cloning plasmid
-
Catalog numberCSB-CL004843HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CCR4 gene.
-
SpecificationsGene name: CCR4; Gene ID: 1233; Accession number: BC071751; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 1083; Sequence: atgaaccccacggatatagcagacaccaccctcgatgaaagcatatacagcaattactatctgtatgaaagtatccccaagccttgcaccaaagaaggcatcaaggcatttggggagctcttcctgcccccactgtattccttggtttttgtatttggtctgcttggaaattctgtggtggttctggtcctgttcaaatacaagcggctcaggtccatgactgatgtgtacctgctcaaccttgccatctcggatctgctcttcgtgttttccctccctttttggggctactatgcagcagaccagtgggtttttgggctaggtctgtgcaagatgatttcctggatgtacttggtgggcttttacagtggcatattctttgtcatgctcatgagcattgatagatacctggcaattgtgcacgcggtgttttccttgagggcaaggaccttgacttatggggtcatcaccagtttggctacatggtcagtggctgtgttcgcctcccttcctggctttctgttcagcacttgttatactgagcgcaaccatacctactgcaaaaccaagtactctctcaactccacgacgtggaaggttctcagctccctggaaatcaacattctcggattggtgatccccttagggatcatgctgttttgctactccatgatcatcaggaccttgcagcattgtaaaaatgagaagaagaacaaggcggtgaagatgatctttgccgtggtggtcctcttccttgggttctggacaccttacaacatagtgctcttcctagagaccctggtggagctagaagtccttcaggactgcacctttgaaagatacttggactatgccatccaggccacagaaactctggcttttgttcactgctgccttaatcccatcatctacttttttctgggggagaaatttcgcaagtacatcctacagctcttcaaaacctgcaggggcctttttgtgctctgccaatactgtgggctcctccaaatttactctgctgacacccccagctcatcttacacgcagtccaccatggatcatgatctccatgatgctctgtag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCNOT6, CCR4
-
Short nameCCR4 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine (C-C motif) receptor 4 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetchemokine (C-C motif) receptor 4, CC-CKR-4 and CD194 and ChemR13 and CKR4 and CMKBR4 and HGCN:14099 and K5-5, CCR4 and IDBG-23908 and ENSG00000183813 and 1233, C-C chemokine receptor activity, Cell surfaces, Ccr4 and IDBG-203512 and ENSMUSG00000047898 and 12773, CCR4 and IDBG-644121 and ENSBTAG00000034883 and 100851774,408019
-
Gene info
-
Identity
-
Gene
-
Long gene nameCCR4-NOT transcription complex subunit 6
-
Synonyms gene name
- CCR4-NOT transcription complex, subunit 6
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-03-30
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- CCR4-NOT transcription complex
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameC-C motif chemokine receptor 4
-
Synonyms gene name
- chemokine (C-C motif) receptor 4
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1996-05-15
-
Entrez gene record
-
Pubmed identfication
-
Classification
- C-C motif chemokine receptors
- CD molecules
-
VEGA ID