AGPAT2 cloning plasmid
-
Catalog numberCSB-CL001450HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the AGPAT2 gene.
-
SpecificationsGene name: AGPAT2; Gene ID: 10555; Accession number: BC004529; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 741; Sequence: atggagctgtggccgtgtctggccgcggcgctgctgttgctgctgctgctggtgcagctgagccgcgcggccgagttctacgccaaggtcgccctgtactgcgcgctgtgcttcacggtgtccgccgtggcctcgctcgtctgcctgctgcgccacggcggccggacggtggagaacatgagcatcatcggctggttcgtgcgaagcttcaagtacttttacgggctccgcttcgaggtgcgggacccgcgcaggctgcaggaggcccgtccctgtgtcatcgtctccaaccaccagagcatcctggacatgatgggcctcatggaggtccttccggagcgctgcgtgcagatcgccaagcgggagctgctcttcctggggcccgtgggcctcatcatgtacctcgggggcgtcttcttcatcaaccggcagcgctctagcactgccatgacagtgatggccgacctgggcgagcgcatggtcagggagaacgtgcccatcgtccccgtggtgtactcttccttctcctccttctacaacaccaagaagaagttcttcacttcaggaacagtcacagtgcaggtgctggaagccatccccaccagcggcctcactgcggcggacgtccctgcgctcgtggacacctgccaccgggccatgaggaccaccttcctccacatctccaagaccccccaggagaacggggccactgcggggtctggcgtgcagccggcccagtag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolAGPAT2
-
Short nameAGPAT2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative name1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, b) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene target1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta), 1-AGPAT2 and BSCL and BSCL1 and LPAAB and LPAAT-beta, AGPAT2 and IDBG-92546 and ENSG00000169692 and 10555, transferase activity, Plasma membranes, Agpat2 and IDBG-149798 and ENSMUSG00000026922 and 67512, BT.22590 and IDBG-640598 and ENSBTAG00000025161 and 512112
-
Gene info
-
Identity
-
Gene
-
Long gene name1-acylglycerol-3-phosphate O-acyltransferase 2
-
Synonyms gene
-
Synonyms gene name
- Berardinelli-Seip congenital lipodystrophy
- 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1999-12-07
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- 1-acylglycerol-3-phosphate O-acyltransferases
-
VEGA ID