TNFRSF14 cloning plasmid
-
Catalog numberCSB-CL842173HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TNFRSF14 gene.
-
SpecificationsGene name: TNFRSF14; Gene ID: 8764; Accession number: BC029848; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 600; Sequence: atggtgtcccggcctccacgtacccctctcagcccctcctcttggactccagccatgggcctgcgcgcgagccggaactgctccaggacagagaacgccgtgtgtggctgcagcccaggccacttctgcatcgtccaggacggggaccaccgcgccgcgtgccgcgcttacgccacctccagcccgggccagagggtgcagaagggaggcaccgagagtcaggacaccctgtgtcagaactgccccccggggaccttctctcccaatgggaccctggaggaatgtcagcaccagaccaagtgcagctggctggtgacgaaggccggagctgggaccagcagctcccactgggtatggtggtttctctcagggagcctcgtcatcgtcattgtttgctccacagttggcctaatcatatgtgtgaaaagaagaaagccaaggggtgatgtagtcaaggtgatcgtctccgtccagcggaaaagacaggaggcagaaggtgaggccacagtcattgaggccctgcaggcccctccggacgtcaccacggtggccgtggaggagacaataccctcattcacggggaggagcccaaaccactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTNFRSF14-AS1, TNFRSF14
-
Short nameTNFRSF14 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametumor necrosis factor receptor superfamily, member 14 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettumor necrosis factor receptor superfamily, member 14, ATAR and CD270 and HVEA and HVEM and LIGHTR and TR2, TNFRSF14 and IDBG-86399 and ENSG00000157873 and 8764, ubiquitin protein ligase binding, Cell surfaces, Tnfrsf14 and IDBG-207237 and ENSMUSG00000042333 and 230979
-
Gene info
-
Identity
-
Gene
-
Long gene nameTNFRSF14 antisense RNA 1
-
Synonyms
-
Locus
-
Discovery year2017-04-27
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene nameTNF receptor superfamily member 14
-
Synonyms gene name
- tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)
- tumor necrosis factor receptor superfamily, member 14
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1998-12-04
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Tumor necrosis factor receptor superfamily
- CD molecules
-
VEGA ID