COL9A1 cloning plasmid
-
Catalog numberCSB-CL005757HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the COL9A1 gene.
-
SpecificationsGene name: COL9A1; Gene ID: 1297; Accession number: BC015409; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 987; Sequence: atgaagacctgctggaaaattccagttttcttctttgtgtgcagtttcctggaaccctgggcatctgcagctgtcaagcgtcgccccagattccctgtcaattccaattctaatggtggaaatgaactctgtccaaagatcaggattggccaagatgacttaccagggtttgatctgatctctcagttccaggtagataaagcagcatctagaagagctatccagagagtagtgggatcagctacattgcaggtggcttacaagttgggaaataatgtagacttcaggattccaactaggaatttatatcccagtggactgcctgaagaatactccttcttgacgacgtttcgaatgactggaagcactctcaaaaagaactggaacatttggcagattcaggattcctctgggaaggagcaagttggcataaagattaatggccaaacacaatctgttgtattttcatacaagggactggatggaagtctccaaacagcagccttttcgaatttgtcctccttgtttgattcccagtggcataagatcatgattggcgtggagaggagtagtgctactctttttgttgactgcaacaggattgaatctttacctataaagccaagaggcccaattgacattgatggctttgctgtgctgggaaaacttgcagataatcctcaagtttctgttccatttgaacttcaatggatgctgatccattgtgaccccctgcggcccaggagagaaacttgccatgagctgccagccagaataacgcccagccagaccaccgacgagagaggtcccccgggtgagcagggtcctcccgggcctccgggcccccctggagttccaggcatcgatggcatcgacggtgaccgaggtcctaagggccccccgggccccccgggtcctgcaggtgaaccgggaaagccaggagctccaggcaagcctggcacacctggcgctgataccagtccttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCOL9A1
-
Short nameCOL9A1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namecollagen, classification IX, a 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetcollagen, type IX, alpha 1, DJ149L1.1.2 and EDM6 and MED and STL4, COL9A1 and IDBG-92000 and ENSG00000112280 and 1297, metal ion binding, Extracellular, Col9a1 and IDBG-138425 and ENSMUSG00000026147 and 12839, COL9A1 and IDBG-629125 and ENSBTAG00000035054 and 282195
-
Gene info
-
Identity
-
Gene
-
Long gene namecollagen type IX alpha 1 chain
-
Synonyms gene name
- collagen, type IX, alpha 1
-
Locus
-
Discovery year1989-05-08
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Collagens
- Collagen proteoglycans
-
VEGA ID