FANCA cloning plasmid
-
Catalog numberCSB-CL008413HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the FANCA gene.
-
SpecificationsGene name: FANCA; Gene ID: 2175; Accession number: BC064540; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 894; Sequence: atgtccgactcgtgggtcccgaactccgcctcgggccaggacccagggggccgccggagggcctgggccgagctgctggcgggaagggtcaagagggaaaaatataatcctgaacgggcacagaaattaaaggaatcagctgtgcgcctcctgcgaagccatcaggacctgaatgcccttttgcttgaggtagaaggtccactgtgtaaaaaattgtctctcagcaaagtgattgactgtgacagttctgaggcctatgctaatcattctagttcatttataggctctgctttgcaggatcaagcctcaaggctgggggttcccgtgggtattctctcagccgggatggttgcctctagcgtgggacagatctgcacggctccagcggagaccagtcaccctgtgctgctgactgtggagcagagaaagaagctgtcttccctgttagagtttgctcagtatttattggcacacagtatgttctcccgtctttccttctgtcaagaattatggaaaatacagagttctttgttgcttgaagcggtgtggcatcttcacgtacaaggcattgtgagcctgcaagagctgctggaaagccatcccgacatgcatgctgtgggatcgtggctcttcaggaatctgtgctgcctttgtgaacagatggaagcatcctgccagcatgctgacgtcgccagggccatgctttctgattttgttcaaatgtttgttttgaggggatttcagaaaaactcagatctgagaagaactgtggagcctgaaaaaatgccgcaggtcgcggttgatgtactgcagagaatgctgatttttgcacttgacgctttggctgctggagtacaggaggagtcctccactcacaagatcgtgaggtgctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolFANCA
-
Short nameFANCA cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameFanconi anemia, complementation family A cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetFanconi anemia, complementation group A, FA and FA-H and FA1 and FAA and FACA and FAH and FANCH, FANCA and IDBG-48213 and ENSG00000187741 and 2175, protein binding, nuclei, Fanca and IDBG-198733 and ENSMUSG00000032815 and 14087, FANCA and IDBG-630970 and ENSBTAG00000001906 and
-
Gene info
-
Identity
-
Gene
-
Long gene nameFA complementation group A
-
Synonyms gene
-
Synonyms gene name
- Fanconi anemia complementation group A
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1995-12-22
-
Entrez gene record
-
Pubmed identfication
-
Classification
- FA complementation groups
- FA core complex
-
VEGA ID
-
Locus Specific Databases