F2RL1 cloning plasmid

• Catalog number
  CSB-CL007925HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the F2RL1 gene.
• Specifications
  Gene name: F2RL1; Gene ID: 2150; Accession number: BC012453; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1194; Sequence: atgcggagccccagcgcggcgtggctgctgggggccgccatcctgctagcagcctctctctcctgcagtggcaccatccaaggaaccaatagatcctctaaaggaagaagccttattggtaaggttgatggcacatcccacgtcactggaaaaggagttacagttgaaacagtcttttctgtggatgagttttctgcatctgtcctcactggaaaactgaccactgtcttccttccaattgtctacacaattgtgtttgtggtgggtttgccaagtaacggcatggccctgtgggtctttcttttccgaactaagaagaagcaccctgctgtgatttacatggccaatctggccttggctgacctcctctctgtcatctggttccccttgaagattgcctatcacatacatggcaacaactggatttatggggaagctctttgtaatgtgcttattggctttttctatggcaacatgtactgttccattctcttcatgacctgcctcagtgtgcagaggtattgggtcatcgtgaaccccatggggcactccaggaagaaggcaaacattgccattggcatctccctggcaatatggctgctgattctgctggtcaccatccctttgtatgtcgtgaagcagaccatcttcattcctgccctgaacatcacgacctgtcatgatgttttgcctgagcagctcttggtgggagacatgttcaattacttcctctctctggccattggggtctttctgttcccagccttcctcacagcctctgcctatgtgctgatgatcagaatgctgcgatcttctgccatggatgaaaactcagagaagaaaaggaagagggccatcaaactcattgtcactgtcctggccatgtacctgatctgcttcactcctagtaaccttctgcttgtggtgcattattttctgattaagagccagggccagagccatgtctatgccctgtacattgtagccctctgcctctctacccttaacagctgcatcgacccctttgtctattactttgtttcacatgatttcagggatcatgcaaagaacgctctcctttgccgaagtgtccgcactgtaaagcagatgcaagtatccctcacctcaaagaaacactccaggaaatccagctcttactcttcaagttcaaccactgttaagacctcctattga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  F2RL1   cloning  
• Gene symbol
  F2RL1
• Short name
  F2RL1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  coagulation factor II (thrombin) receptor-like 1 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  coagulation factor II (thrombin) receptor-like 1, GPR11 and PAR2, F2RL1 and IDBG-29713 and ENSG00000164251 and 2150, G-protein beta-subunit binding, Plasma membranes, F2rl1 and IDBG-173973 and ENSMUSG00000021678 and 14063, BT.28745 and IDBG-645161 and ENSBTAG00000034848 and 526525

Gene info

• Identity
  HGNC:3538
• Gene
  F2RL1
• Long gene name
  F2R like trypsin receptor 1
• Synonyms gene
  • GPR11
• Synonyms gene name
  • coagulation factor II (thrombin) receptor-like 1
• Synonyms
  • PAR2
• Synonyms name
  • proteinase-activated receptor-2
• GenBank acession
  • BC018130
• Locus
  5q13.3
• Discovery year
  1997-10-27
• Entrez gene record
  2150
• Pubmed identfication
  • 7937743
  • 7556175
• RefSeq identity
  • NM_005242
• Classification
  • F2R receptors
• VEGA ID
  OTTHUMG00000102118

Similar products