SERPINB2 cloning plasmid

• Catalog number
  CSB-CL021070HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the SERPINB2 gene.
• Specifications
  Gene name: SERPINB2; Gene ID: 5055; Accession number: BC012609; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1248; Sequence: atggaggatctttgtgtggcaaacacactctttgccctcaatttattcaagcatctggcaaaagcaagccccacccagaacctcttcctctccccatggagcatctcgtccaccatggccatggtctacatgggctccaggggcagcaccgaagaccagatggccaaggtgcttcagtttaatgaagtgggagccaatgcagttacccccatgactccagagaactttaccagctgtgggttcatgcagcagatccagaagggtagttatcctgatgcgattttgcaggcacaagctgcagataaaatccattcatccttccgctctctcagctctgcaatcaatgcatccacagggaattatttactggaaagtgtcaataagctgtttggtgagaagtctgcgagcttccgggaagaatatattcgactctgtcagaaatattactcctcagaaccccaggcagtagacttcctagaatgtgcagaagaagctagaaaaaagatttattcctgggtcaagactcaaaccaaaggcaaaatcccaaacttgttacctgaaggttctgtagatggggataccaggatggtcctggtgaatgctgtctacttcaaaggaaagtggaaaactccatttgagaagaaactaaatgggctttatcctttccgtgtaaactcggctcagcgcacacctgtacagatgatgtacttgcgtgaaaagctaaacattggatacatagaagacctaaaggctcagattctagaactcccatatgctggagatgttagcatgttcttgttgcttccagatgaaattgccgatgtgtccactggcttggagctgctggaaagtgaaataacctatgacaaactcaacaagtggaccagcaaagacaaaatggctgaagatgaagttgaggtatacataccccagttcaaattagaagagcattatgaactcagatccattctgagaagcatgggcatggaggacgccttcaacaagggacgggccaatttctcagggatgtcggagaggaatgacctgtttctttctgaagtgttccaccaagccatggtggatgtgaatgaggagggcactgaagcagccgctggcacaggaggtgttatgacagggagaactggacatggaggcccacagtttgtggcagatcatccttttctttttcttattatgcataagataaccaactgcattttatttttcggcagattttcctcaccctaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  SERPINB2   cloning  
• Gene symbol
  SERPINB2
• Short name
  SERPINB2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  serpin peptidase inhibitor, clade B (ovalbumin), member 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  serpin peptidase inhibitor, clade B (ovalbumin), member 2, HsT1201 and PAI and PAI-2 and PAI2 and PLANH2, SERPINB2 and IDBG-4558 and ENSG00000197632 and 5055, serine-type endopeptidase inhibitor activity, Extracellular, Serpinb2 and IDBG-186363 and ENSMUSG00000062345 and 18788

Gene info

• Identity
  HGNC:8584
• Gene
  SERPINB2
• Long gene name
  serpin family B member 2
• Synonyms gene
  • PLANH2
  • PAI2
• Synonyms gene name
  • serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2
  • serpin peptidase inhibitor, clade B (ovalbumin), member 2
• Synonyms
  • HsT1201
  • PAI-2
• Synonyms name
  • plasminogen-activator inhibitor
• GenBank acession
  • Y00630
• Locus
  18q21.33-q22.1
• Discovery year
  1989-02-07
• Entrez gene record
  5055
• Pubmed identfication
  • 24172014
• RefSeq identity
  • NM_002575
• Classification
  • Serpin peptidase inhibitors
• VEGA ID
  OTTHUMG00000060592

Similar products