PTPRK cloning plasmid
-
Catalog numberCSB-CL613588HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PTPRK gene.
-
SpecificationsGene name: PTPRK; Gene ID: 5796; Accession number: BC063596; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 234; Sequence: atggatacgactgcggcggcggcgctgcctgcttttgtggcgctcttgctcctctctccttggcctctcctgggatcggcccaaggccagttctccgcagtgtctgtgcttgtggtcggtaacttttgctgctgttgttctgctgctgtctgccattccattcgccatctatcacgcacacagaaccctggccaggatcatgaagggcgattgaaaaggtggctgtacttttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPTPRK-AS1, PTPRK
-
Short namePTPRK cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameprotein tyrosine phosphatase, receptor classification, K cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetprotein tyrosine phosphatase, receptor type, K, R-PTP-kappa, PTPRK and IDBG-96274 and ENSG00000152894 and 5796, gamma-catenin binding, Cell surfaces, Ptprk and IDBG-141451 and ENSMUSG00000019889 and 19272, PTPRK and IDBG-632960 and ENSBTAG00000020829 and 509657
-
Gene info
-
Identity
-
Gene
-
Long gene namePTPRK antisense RNA 1
-
Locus
-
Discovery year2020-03-19
-
Entrez gene record
-
RefSeq identity
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene nameprotein tyrosine phosphatase receptor type K
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-02-09
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Protein tyrosine phosphatases receptor type
- Fibronectin type III domain containing
- Immunoglobulin like domain containing
-
VEGA ID