OPCML cloning plasmid

  • Catalog number
    CSB-CL621799HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the OPCML gene.
  • Specifications
    Gene name: OPCML; Gene ID: 4978; Accession number: BC117254; Vector: pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1038; Sequence: atgggggtctgtgggtacctgttcctgccctggaagtgcctcgtggtcgtgtctctcaggctgctgttccttgtacccacaggagtgcccgtgcgcagcggagatgccaccttccccaaagctatggacaacgtgacggtccggcagggggagagcgccaccctcaggtgtaccatagatgaccgggtaacccgggtggcctggctaaaccgcagcaccatcctctacgctgggaatgacaagtggtccatagaccctcgtgtgatcatcctggtcaatacaccaacccagtacagcatcatgatccaaaatgtggatgtgtatgacgaaggtccgtacacctgctctgtgcagacagacaatcatcccaaaacgtcccgggttcacctaatagtgcaagttcctcctcagatcatgaatatctcctcagacatcactgtgaatgagggaagcagtgtgaccctgctgtgtcttgctattggcagaccagagccaactgtgacatggagacacctgtcagtcaaggaaggccagggctttgtaagtgaggatgagtacctggagatctctgacatcaagcgagaccagtccggggagtacgaatgcagcgcgttgaacgatgtcgctgcgcccgatgtgcggaaagtaaaaatcactgtaaactatcctccctatatctcaaaagccaagaacactggtgtttcagtcggtcagaagggcatcctgagctgtgaagcctctgcagtccccatggctgaattccagtggttcaaggaagaaaccaggttagccactggtctggatggaatgaggattgaaaacaaaggccgcatgtccactctgactttcttcaatgtttcagaaaaggattatgggaactatacttgtgtggccacgaacaagcttgggaacaccaatgccagcatcacattgtatgggcctggagcagtcattgatggtgtaaactcggcctccagagcactggcttgtctctggctatcagggaccctcttagcccacttcttcatcaagttttga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    OPCML   cloning  
  • Gene symbol
    OPCML-IT2, OPCML-IT1, OPCML
  • Short name
    OPCML cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    opioid binding protein/cellular adhesion molecule-like cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    opioid binding protein/cell adhesion molecule-like, IGLON1 and OBCAM and OPCM, OPCML and IDBG-76356 and ENSG00000183715 and 4978, protein binding, Plasma membranes, Opcml and IDBG-146160 and ENSMUSG00000062257 and 330908, OPCML and IDBG-642835 and ENSBTAG00000020769 and
Gene info
  • Identity
  • Gene
  • Long gene name
    OPCML intronic transcript 2
  • Synonyms gene name
    • OPCML intronic transcript 2 (non-protein coding)
  • Locus
  • Discovery year
    2011-05-19
  • Classification
    • Intronic transcripts
  • VEGA ID
Gene info
  • Identity
  • Gene
  • Long gene name
    OPCML intronic transcript 1
  • Synonyms gene name
    • OPCML intronic transcript 1 (non-protein coding)
  • Locus
  • Discovery year
    2011-05-19
  • Classification
    • Intronic transcripts
  • VEGA ID
Gene info
Similar products
Filters
Contact
Chat with gentaur.com employee