ELOVL1 cloning plasmid

  • Catalog number
    CSB-CL887138HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the ELOVL1 gene.
  • Specifications
    Gene name: ELOVL1; Gene ID: 64834; Accession number: BC000618; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 840; Sequence: atggaggctgttgtgaacttgtaccaagaggtgatgaagcacgcagatccccggatccagggctaccctctgatggggtcccccttgctaatgacctccattctcctgacctacgtgtacttcgttctctcacttgggcctcgcatcatggctaatcggaagcccttccagctccgtggcttcatgattgtctacaacttctcactggtggcactctccctctacattgtctatgagttcctgatgtcgggctggctgagcacctatacctggcgctgtgaccctgtggactattccaacagccctgaggcacttaggatggttcgggtggcctggctcttcctcttctccaagttcattgagctgatggacacagtgatctttattctccgaaagaaagacgggcaggtgaccttcctacatgtcttccatcactctgtgcttccctggagctggtggtggggggtaaagattgccccgggaggaatgggctctttccatgccatgataaactcttccgtgcatgtcataatgtacctgtactacggattatctgcctttggccctgtggcacaaccctacctttggtggaaaaagcacatgacagccattcagctgatccagtttgtcctggtctcactgcacatctcccagtactactttatgtccagctgtaactaccagtacccagtcattattcacctcatctggatgtatggcaccatcttcttcatgctgttctccaacttctggtatcactcttataccaagggcaagcggctgccccgtgcacttcagcaaaatggagctccaggtattgccaaggtcaaggccaactga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    ELOVL1   cloning  
  • Gene symbol
    ELOVL1
  • Short name
    ELOVL1 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    ELOVL1 cloning plasmid
  • Alternative technique
    plasmids
Gene info
  • Identity
  • Gene
  • Long gene name
    ELOVL fatty acid elongase 1
  • Synonyms gene name
    • elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2001-01-18
  • Entrez gene record
  • RefSeq identity
  • Classification
    • MicroRNA protein coding host genes
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee