IFT20 cloning plasmid
-
Catalog numberCSB-CL810295HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the IFT20 gene.
-
SpecificationsGene name: IFT20; Gene ID: 90410; Accession number: BC038094; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 399; Sequence: atggccaaggacatcctgggtgaagcagggctacactttgatgaactgaacaagctgagggtgttggacccagaggttacccagcagaccatagagctgaaggaagagtgcaaagactttgtggacaaaattggccagtttcagaaaatagttggtggtttaattgagcttgttgatcaacttgcaaaagaagcagaaaatgaaaagatgaaggccatcggtgctcggaacttgctcaaatctatagcaaagcagagagaagctcaacagcagcaacttcaagccctaatagcagaaaagaaaatgcagctagaaaggtatcgggttgaatatgaagctttgtgtaaagtagaagcagaacaaaatgaatttattgaccaatttatttttcagaaatga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolIFT20
-
Short nameIFT20 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameintraflagellar transport 20 homolog (Chlamydomonas) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetintraflagellar transport 20 homolog (Chlamydomonas), IFT20 and IDBG-36364 and ENSG00000109083 and 90410, protein binding, Cytoplasm, Ift20 and IDBG-203058 and ENSMUSG00000001105 and 55978, IFT20 and IDBG-631552 and ENSBTAG00000008110 and 445364
-
Gene info
-
Identity
-
Gene
-
Long gene nameintraflagellar transport 20
-
Synonyms gene name
- intraflagellar transport 20 homolog (Chlamydomonas)
-
GenBank acession
-
Locus
-
Discovery year2005-11-02
-
Entrez gene record
-
RefSeq identity
-
Classification
- IFT-B2 complex
-
VEGA ID