HMGB2 cloning plasmid
-
Catalog numberCSB-CL010560HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the HMGB2 gene.
-
SpecificationsGene name: HMGB2; Gene ID: 3148; Accession number: BC001063; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 630; Sequence: atgggtaaaggagaccccaacaagccgcggggcaaaatgtcctcgtacgccttcttcgtgcagacctgccgggaagagcacaagaagaaacacccggactcttccgtcaatttcgcggaattctccaagaagtgttcggagagatggaagaccatgtctgcaaaggagaagtcgaagtttgaagatatggcaaaaagtgacaaagctcgctatgacagggagatgaaaaattacgttcctcccaaaggtgataagaaggggaagaaaaaggaccccaatgctcctaaaaggccaccatctgccttcttcctgttttgctctgaacatcgcccaaagatcaaaagtgaacaccctggcctatccattggggatactgcaaagaaattgggtgaaatgtggtctgagcagtcagccaaagataaacaaccatatgaacagaaagcagctaagctaaaggagaaatatgaaaaggatattgctgcatatcgtgccaagggcaaaagtgaagcaggaaagaagggccctggcaggccaacaggctcaaagaagaagaacgaaccagaagatgaggaggaggaggaggaagaagaagatgaagatgaggaggaagaggatgaagatgaagaataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolHMGB2
-
Short nameHMGB2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namehigh mobility group box 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targethigh mobility group box 2, HMG2, HMGB2 and IDBG-44657 and ENSG00000164104 and 3148, DNA binding, nuclei, Hmgb2 and IDBG-156235 and ENSMUSG00000054717 and 97165, HMGB2 and IDBG-629304 and ENSBTAG00000015101 and 540444,618297
-
Gene info
-
Identity
-
Gene
-
Long gene namehigh mobility group box 2
-
Synonyms gene
-
Synonyms gene name
- high-mobility group (nonhistone chromosomal) protein 2
- high-mobility group box 2
-
Locus
-
Discovery year1993-12-13
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Canonical high mobility group
- SET complex
-
VEGA ID