BLCAP cloning plasmid
-
Catalog numberCSB-CL002712HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the BLCAP gene.
-
SpecificationsGene name: BLCAP; Gene ID: 10904; Accession number: BC047692; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 264; Sequence: atgtattgcctccagtggctgctgcccgtcctcctcatccccaagcccctcaaccccgccctgtggttcagccactccatgttcatgggcttctacctgctcagcttcctcctggaacggaagccttgcacaatttgtgccttggttttcctggcagccctgttccttatctgctatagctgctggggaaactgtttcctgtaccactgctccgattccccgcttccagaatcggcgcatgatcccggcgttgtgggcacctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolBLCAP
-
Short nameBLCAP cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namebladder cancer associated protein cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetbladder cancer associated protein, BC10, BLCAP and IDBG-74305 and ENSG00000166619 and 10904, protein binding, Plasma membranes, Blcap and IDBG-211301 and ENSMUSG00000067787 and 53619, BLCAP and IDBG-642566 and ENSBTAG00000003209 and 281649
-
Gene info
-
Identity
-
Gene
-
Long gene nameBLCAP apoptosis inducing factor
-
Synonyms gene name
- bladder cancer associated protein
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2000-05-26
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID