EDN1 cloning plasmid
-
Catalog numberCSB-CL007400HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the EDN1 gene.
-
SpecificationsGene name: EDN1; Gene ID: 1906; Accession number: BC009720; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 639; Sequence: atggattatttgctcatgattttctctctgctgtttgtggcttgccaaggagctccagaaacagcagtcttaggcgctgagctcagcgcggtgggtgagaacggcggggagaaacccactcccagtccaccctggcggctccgccggtccaagcgctgctcctgctcgtccctgatggataaagagtgtgtctacttctgccacctggacatcatttgggtcaacactcccgagcacgttgttccgtatggacttggaagccctaggtccaagagagccttggagaatttacttcccacaaaggcaacagaccgtgagaatagatgccaatgtgctagccaaaaagacaagaagtgctggaatttttgccaagcaggaaaagaactcagggctgaagacattatggagaaagactggaataatcataagaaaggaaaagactgttccaagcttgggaaaaagtgtatttatcagcagttagtgagaggaagaaaaatcagaagaagttcagaggaacacctaagacaaaccaggtcggagaccatgagaaacagcgtcaaatcatcttttcatgatcccaagctgaaaggcaatccctccagagagcgttatgtgacccacaaccgagcacattggtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolEDN1
-
Short nameEDN1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameendothelin 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetendothelin 1, ARCND3 and ET1 and HDLCQ7 and PPET1 and QME, EDN1 and IDBG-61847 and ENSG00000078401 and 1906, endothelin B receptor binding, Extracellular, Edn1 and IDBG-147056 and ENSMUSG00000021367 and 13614, EDN1 and IDBG-636110 and ENSBTAG00000008096 and 281137
-
Gene info
-
Identity
-
Gene
-
Long gene nameendothelin 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1989-04-06
-
Entrez gene record
-
RefSeq identity
-
Classification
- Endothelins
-
VEGA ID