SLC25A6 cloning plasmid

• Catalog number
  CSB-CL021520HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the SLC25A6 gene.
• Specifications
  Gene name: SLC25A6; Gene ID: 293; Accession number: BC031912; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 897; Sequence: atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgtccgcatccccaaggagcagggcgtgctgtccttctggaggggcaaccttgccaacgtcattcgctacttccccactcaagccctcaacttcgccttcaaggataagtacaagcagatcttcctggggggcgtggacaagcacacgcagttctggaggtactttgcgggcaacctggcctccggcggtgcggccggcgcgacctccctctgcttcgtgtacccgctggattttgccagaacccgcctggcagcggacgtgggaaagtcaggcacagagcgcgagttccgaggcctgggagactgcctggtgaagatcaccaagtccgacggcatccggggcctgtaccagggcttcagtgtctccgtgcagggcatcatcatctaccgggcggcctacttcggcgtgtacgatacggccaagggcatgctccccgaccccaagaacacgcacatcgtggtgagctggatgatcgcgcagaccgtgacggccgtggccggcgtggtgtcctaccccttcgacacggtgcggcggcgcatgatgatgcagtccgggcgcaaaggagctgacatcatgtacacgggcaccgtcgactgttggaggaagatcttcagagatgaggggggcaaggccttcttcaagggtgcgtggtccaacgtcctgcggggcatggggggcgccttcgtgctggtcctgtacgacgagctcaagaaggtgatctaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  SLC25A6   cloning  
• Gene symbol
  SLC25A6
• Short name
  SLC25A6 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6, 2 and 3 and AAC3 and ANT and ANT 2 and ANT 3 and ANT3 and ANT3Y, SLC25A6 and IDBG-39774 and ENSG00000169100 and 293, protein binding, nuclei, CH36-396L14.2 and IDBG-767696 and ENSMUSG00000102088 and, SLC25A6 and IDBG-766321 and ENSBTAG00000047418 and 282480

Gene info

• Identity
  HGNC:10992
• Gene
  SLC25A6
• Long gene name
  solute carrier family 25 member 6
• Synonyms gene
  • ANT3
• Synonyms gene name
  • solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6
• Synonyms
  • ANT3Y
  • MGC17525
• GenBank acession
  • AY007135
• Locus
  Xp22.32 and Yp11.3
• Discovery year
  1990-08-03
• Entrez gene record
  293
• RefSeq identity
  • NM_001636
• Classification
  • Solute carriers
  • Pseudoautosomal region 1
• VEGA ID
  OTTHUMG00000021058
• Locus Specific Databases
  • Global Variome shared LOVD

Similar products