CALCOCO2 cloning plasmid

• Catalog number
  CSB-CL614394HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CALCOCO2 gene.
• Specifications
  Gene name: CALCOCO2; Gene ID: 10241; Accession number: BC004130; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1341; Sequence: atggaggagaccatcaaagatccccccacatcagctgtcttgctggatcactgtcatttctctcaggtcatctttaacagtgtggagaagttctacatccctggaggggacgtcacatgtcattataccttcacccagcatttcatccctcgtcgaaaggattggattggcatctttagagtggggtggaagacaacccgtgagtattacaccttcatgtgggttactttgcccattgacctaaacaacaaatcagctaaacagcaggaagtccaattcaaagcttactacctgcccaaggatgatgagtattaccagttctgctatgtggatgaggatggtgtggtccggggagcaagtattcctttccaattccgtccagaaaatgaggaagacatcctggttgttaccactcagggagaggtggaagagattgagcagcacaacaaggagctttgcaaagaaaaccaggagctgaaggacagctgtatcagcctccagaagcagaactcagacatgcaggctgagctccaaaagaagcaggaggagctagaaaccctacagagcatcaataagaagttggaactgaaagtgaaagaacagaaggactattgggagacagagctgcttcaactgaaagaacaaaaccagaagatgtcctcagaaaatgagaagatgggaatcagagtggatcagcttcaggcccagctgtcaactcaagagaaagaaatggagaagcttgttcagggagatcaagataagacagagcagttagagcagctgaaaaaggaaaatgaccacctctttctcagtttagctgaacagaggaaggaccagaagaagctcgagcagacagtggagcaaatgaagcagaatgaaactactgcaatgaagaaacaacaggaattaatggatgaaaactttgacctgtcaaaaagactgagtgagaacgaaattatatgtaatgctctgcagagacagaaagagagattggaaggagaaaatgatcttttgaagagggagaacagcagattgctcagttacatgggtctggattttaattctttgccgtatcaagtacctacttcagatgaaggaggcgcaagacaaaatccaggacttgcctatggaaacccatattctggtatccaagaaagttcttcccccagcccgctctccatcaagaaatgccctatctgcaaagcagatgatatttgtgatcacaccttggagcaacagcagatgcagcccctttgtttcaattgtccaatttgtgacaagatcttcccagctacagagaagcagatctttgaagaccacgtgttctgccactctctctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CALCOCO2   cloning  
• Gene symbol
  CALCOCO2
• Short name
  CALCOCO2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  calcium binding and coiled-coil domain 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  calcium binding and coiled-coil domain 2, NDP52, CALCOCO2 and IDBG-57242 and ENSG00000136436 and 10241, protein homodimerization activity, nuclei, Calcoco2 and IDBG-209835 and ENSMUSG00000006056 and 102642271,76815, CALCOCO2 and IDBG-638886 and ENSBTAG00000007935 and 281942

Gene info

• Identity
  HGNC:29912
• Gene
  CALCOCO2
• Long gene name
  calcium binding and coiled-coil domain 2
• Synonyms
  • MGC17318
  • NDP52
• GenBank acession
  • BC004130
• Locus
  17q21.32
• Discovery year
  2006-01-27
• Entrez gene record
  10241
• Pubmed identfication
  • 7540613
  • 26506893
• RefSeq identity
  • NM_005831
• VEGA ID
  OTTHUMG00000160505

Similar products