NRGN cloning plasmid

Description

A cloning plasmid for the NRGN gene.
Specifications

Gene name: NRGN; Gene ID: 4900; Accession number: BC002835; Vector: pUC
Additional_information

Formulation: 10 μg plasmid + 200μl Glycerol; Length: 237; Sequence: atggactgctgcaccgagaacgcctgctccaagccggacgacgacattctagacatcccgctggacgatcccggcgccaacgcggccgccgccaaaatccaggcgagttttcggggccacatggcgcggaagaagataaagagcggagagcgcggccggaagggcccgggccctggggggcctggcggagctggggtggcccggggaggcgcgggcggcggccccagcggagactag
Storage_and_shipping

Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
Notes

For research use only.
Kit

Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

Gene target

NRGN cloning
Gene symbol

NRGN
Short name

NRGN cloning plasmid
Technique

plasmid, plasmids in 1
Alternative name

neurogranin (protein kinase C substrate, RC3) cloning plasmid
Alternative technique

plasmids
Alternative to gene target

neurogranin (protein kinase C substrate, RC3), hng and RC3, NRGN and IDBG-75248 and ENSG00000154146 and 4900, calmodulin binding, multiple, Nrgn and IDBG-150509 and ENSMUSG00000053310 and 64011, NRGN and IDBG-642607 and ENSBTAG00000001474 and 616955