NRGN cloning plasmid
-
Catalog numberCSB-CL849776HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the NRGN gene.
-
SpecificationsGene name: NRGN; Gene ID: 4900; Accession number: BC002835; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 237; Sequence: atggactgctgcaccgagaacgcctgctccaagccggacgacgacattctagacatcccgctggacgatcccggcgccaacgcggccgccgccaaaatccaggcgagttttcggggccacatggcgcggaagaagataaagagcggagagcgcggccggaagggcccgggccctggggggcctggcggagctggggtggcccggggaggcgcgggcggcggccccagcggagactag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolNRGN
-
Short nameNRGN cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameneurogranin (protein kinase C substrate, RC3) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetneurogranin (protein kinase C substrate, RC3), hng and RC3, NRGN and IDBG-75248 and ENSG00000154146 and 4900, calmodulin binding, multiple, Nrgn and IDBG-150509 and ENSMUSG00000053310 and 64011, NRGN and IDBG-642607 and ENSBTAG00000001474 and 616955
-
Gene info
-
Identity
-
Gene
-
Long gene nameneurogranin
-
Synonyms gene name
- neurogranin (protein kinase C substrate, RC3)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1996-07-17
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID