DUSP3 cloning plasmid
-
Catalog numberCSB-CL007255HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the DUSP3 gene.
-
SpecificationsGene name: DUSP3; Gene ID: 1845; Accession number: BC002682; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 558; Sequence: atgtcgggctcgttcgagctctcggtgcaggatctcaacgacctgctctcggacggcagcggctgctacagcctcccgagccagccctgcaacgaggtcaccccgcggatctacgtgggcaacgcgtctgtggctcaggacatccccaagctgcagaaactaggcatcacccatgtgctgaacgcggctgagggcaggtccttcatgcacgtcaacaccaatgccaacttctacaaggactccggcatcacatacctgggcatcaaggccaacgacacacaggagttcaacctcagcgcttactttgaaagggctgccgacttcattgaccaggctttggctcaaaagaatggccgggtgctcgtccactgccgggaaggttatagccgctccccaacgctagttatcgcctacctcatgatgcggcagaagatggacgtcaagtctgccctgagcatcgtgaggcagaaccgtgagatcggccccaacgatggcttcctggcccagctctgccagctcaatgacagactagccaaggaggggaagttgaaaccctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolDUSP3
-
Short nameDUSP3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namedual specificity phosphatase 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetdual specificity phosphatase 3, VHR, DUSP3 and IDBG-52945 and ENSG00000108861 and 1845, MAP kinase phosphatase activity, nuclei, Dusp3 and IDBG-212400 and ENSMUSG00000003518 and 72349, DUSP3 and IDBG-640759 and ENSBTAG00000003966 and 615432
-
Gene info
-
Identity
-
Gene
-
Long gene namedual specificity phosphatase 3
-
Synonyms gene
-
Synonyms gene name
- vaccinia virus phosphatase VH1-related
-
GenBank acession
-
Locus
-
Discovery year1994-05-19
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Atypical dual specificity phosphatases
-
VEGA ID