XPA cloning plasmid

• Catalog number
  CSB-CL026216HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the XPA gene.
• Specifications
  Gene name: XPA; Gene ID: 7507; Accession number: BC014965; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 822; Sequence: atggcggcggccgacggggctttgccggaggcggcggctttagagcaacccgcggagctgcctgcctcggtgcgggcgagtatcgagcggaagcggcagcgggcactgatgctgcgccaggcccggctggctgcccggccctactcggcgacggcggctgcggctactggaggcatggctaatgtaaaagcagccccaaagataattgacacaggaggaggcttcattttagaagaggaagaagaagaagaacagaaaattggaaaagttgttcatcaaccaggacctgttatggaatttgattatgtaatatgcgaagaatgtgggaaagaatttatggattcttatcttatgaaccactttgatttgccaacttgtgataactgcagagatgctgatgataaacacaagcttataaccaaaacagaggcaaaacaagaatatcttctgaaagactgtgatttagaaaaaagagagccacctcttaaatttattgtgaagaagaatccacatcattcacaatggggtgatatgaaactctacttaaagttacagattgtgaagaggtctcttgaagtttggggtagtcaagaagcattagaagaagcaaaggaagtccgacaggaaaaccgagaaaaaatgaaacagaagaaatttgataaaaaagtaaaagaattgcggcgagcagtaagaagcagcgtgtggaaaagggagacgattgttcatcaacatgagtatggaccagaagaaaacctagaagatgacatgtaccgtaagacttgtactatgtgtggccatgaactgacatatgaaaaaatgtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  XPA   cloning  
• Gene symbol
  XPA
• Short name
  XPA cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  xeroderma pigmentosum, complementation group A cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  xeroderma pigmentosum, complementation group A, XPA and IDBG-78000 and ENSG00000136936 and 7507, metal ion binding, nuclei, Xpa and IDBG-145025 and ENSMUSG00000028329 and 22590, XPA and IDBG-633992 and ENSBTAG00000009734 and 537958

Gene info

• Identity
  HGNC:12814
• Gene
  XPA
• Long gene name
  XPA, DNA damage recognition and repair factor
• Synonyms gene name
  • xeroderma pigmentosum, complementation group A
• Synonyms
  • XPAC
  • XP1
• GenBank acession
  • D14533
• Locus
  9q22.33
• Discovery year
  1990-09-10
• Entrez gene record
  7507
• RefSeq identity
  • NM_000380
• Classification
  • Xeroderma pigmentosum complementation groups
• VEGA ID
  OTTHUMG00000020330
• Locus Specific Databases
  • LRG_471

Similar products