CCR9 cloning plasmid
-
Catalog numberCSB-CL004848HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CCR9 gene.
-
SpecificationsGene name: CCR9; Gene ID: 10803; Accession number: BC069678; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 1110; Sequence: atgacacccacagacttcacaagccctattcctaacatggctgatgactatggctctgaatccacatcttccatggaagactacgttaacttcaacttcactgacttctactgtgagaaaaacaatgtcaggcagtttgcgagccatttcctcccacccttgtactggctcgtgttcatcgtgggtgccttgggcaacagtcttgttatccttgtctactggtactgcacaagagtgaagaccatgaccgacatgttccttttgaatttggcaattgctgacctcctctttcttgtcactcttcccttctgggccattgctgctgctgaccagtggaagttccagaccttcatgtgcaaggtggtcaacagcatgtacaagatgaacttctacagctgtgtgttgctgatcatgtgcatcagcgtggacaggtacattgccattgcccaggccatgagagcacatacttggagggagaaaaggcttttgtacagcaaaatggtttgctttaccatctgggtattggcagctgctctctgcatcccagaaatcttatacagccaaatcaaggaggaatccggcattgctatctgcaccatggtttaccctagcgatgagagcaccaaactgaagtcagctgtcttgaccctgaaggtcattctggggttcttccttcccttcgtggtcatggcttgctgctataccatcatcattcacaccctgatacaagccaagaagtcttccaagcacaaagccctaaaagtgaccatcactgtcctgaccgtctttgtcttgtctcagtttccctacaactgcattttgttggtgcagaccattgacgcctatgccatgttcatctccaactgtgccgtttccaccaacattgacatctgcttccaggtcacccagaccatcgccttcttccacagttgcctgaaccctgttctctatgtttttgtgggtgagagattccgccgggatctcgtgaaaaccctgaagaacttgggttgcatcagccaggcccagtgggtttcatttacaaggagagagggaagcttgaagctgtcgtctatgttgctggagacaacctcaggagcactctccctctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCCR9, ACKR2
-
Short nameCCR9 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine (C-C motif) receptor 9 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetchemokine (C-C motif) receptor 9, CC-CKR-9 and CDw199 and GPR-9-6 and GPR28, CCR9 and IDBG-29830 and ENSG00000173585 and 10803, C-C chemokine receptor activity, Plasma membranes, Ccr9 and IDBG-206422 and ENSMUSG00000029530 and 12769, CCR9 and IDBG-646262 and ENSBTAG00000031348 and 530951
-
Gene info
-
Identity
-
Gene
-
Long gene nameC-C motif chemokine receptor 9
-
Synonyms gene
-
Synonyms gene name
- chemokine (C-C motif) receptor 9
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1999-09-17
-
Entrez gene record
-
Pubmed identfication
-
Classification
- C-C motif chemokine receptors
- CD molecules
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameatypical chemokine receptor 2
-
Synonyms gene
-
Synonyms gene name
- chemokine binding protein 2
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-04-28
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Atypical chemokine receptors
-
VEGA ID