EBAG9 cloning plasmid
-
Catalog numberCSB-CL007355HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the EBAG9 gene.
-
SpecificationsGene name: EBAG9; Gene ID: 9166; Accession number: BC005249; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 642; Sequence: atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaagagtggacttcctgggatgaagatgcacccaccagtgtaaagatcgaaggagggaatgggaatgtggcaacacaacaaaattctttggaacaactggaacctgactattttaaggacatgacaccaactattaggaaaactcagaaaattgttattaagaagagagaaccattgaattttggcatcccagatgggagcacaggtttctctagtagattagcagctacacaagatctgccttttattcatcagtcttctgaattaggtgacttagatacctggcaggaaaataccaatgcatgggaagaagaagaagatgcagcctggcaagcagaagaagttctgagacagcagaaactagcagacagagaagagagagcagccgaacaacaaaggaagaaaatggaaaaggaagcacaacggctaatgaagaaggaacaaaacaaaattggtgtgaaactttcataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolEBAG9
-
Short nameEBAG9 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameestrogen receptor binding site associated, antigen, 9 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetestrogen receptor binding site associated, antigen, 9, EB9 and PDAF, EBAG9 and IDBG-32695 and ENSG00000147654 and 9166, peptidase activator activity involved in apoptotic process, Cell surfaces, Ebag9 and IDBG-138891 and ENSMUSG00000022339 and 55960, EBAG9 and IDBG-644923 and ENSBTAG00000037571 and 538551
-
Gene info
-
Identity
-
Gene
-
Long gene nameestrogen receptor binding site associated antigen 9
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2000-03-30
-
Entrez gene record
-
RefSeq identity
-
VEGA ID