XCL1 cloning plasmid
-
Catalog numberCSB-CL026186HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the XCL1 gene.
-
SpecificationsGene name: XCL1; Gene ID: 6375; Accession number: BC070309; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 345; Sequence: atgagacttctcatcctggccctccttggcatctgctctctcactgcatacattgtggaaggtgtagggagtgaagtctcagataagaggacctgtgtgagcctcactacccagcgactgccggttagcagaatcaagacctacaccatcacggaaggctccttgagagcagtaatttttattaccaaacgtggcctaaaagtctgtgctgatccacaagccacatgggtgagagacgtggtcaggagcatggacaggaaatccaacaccagaaataacatgatccagaccaagccaacaggaacccagcaatcgaccaatacagctgtgactctgactggctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolXCL1
-
Short nameXCL1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine (C motif) ligand 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetchemokine (C motif) ligand 1, ATAC and LPTN and LTN and SCM-1 and SCM-1a and SCM1 and SCM1A and SCYC1, XCL1 and IDBG-104633 and ENSG00000143184 and 6375, protein homodimerization activity, Extracellular
-
Gene info
-
Identity
-
Gene
-
Long gene nameX-C motif chemokine ligand 1
-
Synonyms gene
-
Synonyms gene name
- small inducible cytokine subfamily C, member 1 (lymphotactin)
- chemokine (C motif) ligand 1
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1996-03-19
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Chemokine ligands
-
VEGA ID