CCL28 cloning plasmid
-
Catalog numberCSB-CL868302HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CCL28 gene.
-
SpecificationsGene name: CCL28; Gene ID: 56477; Accession number: BC069532; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 384; Sequence: atgcagcagagaggactcgccatcgtggccttggctgtctgtgcggccctacatgcctcagaagccatacttcccattgcctccagctgttgcacggaggtttcacatcatatttccagaaggctcctggaaagagtgaatatgtgtcgcatccagagagctgatggggattgtgacttggctgctgtcatccttcatgtcaagcgcagaagaatctgtgtcagcccgcacaaccatactgttaagcagtggatgaaagtgcaagctgccaagaaaaatggtaaaggaaatgtttgccacaggaagaaacaccatggcaagaggaacagtaacagggcacatcaggggaaacacgaaacatacggccataaaactccttattag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCCL28
-
Short nameCCL28 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine (C-C motif) ligand 28 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetchemokine (C-C motif) ligand 28, CCL28 and IDBG-19270 and ENSG00000151882 and 56477, chemokine activity, Extracellular, Ccl28 and IDBG-705098 and ENSMUSG00000074715 and 56838, CCL28 and IDBG-629570 and ENSBTAG00000001557 and 535328
-
Gene info
-
Identity
-
Gene
-
Long gene nameC-C motif chemokine ligand 28
-
Synonyms gene name
- chemokine (C-C motif) ligand 28
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2002-08-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Chemokine ligands
-
VEGA ID