NEGR1 cloning plasmid
-
Catalog numberCSB-CL015692HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the NEGR1 gene.
-
SpecificationsGene name: NEGR1; Gene ID: 257194; Accession number: BC036771; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 681; Sequence: atgcaggtgcatctaactgtgcaagttcctcctaagatatatgacatctcaaatgatatgaccgtcaatgaaggaaccaacgtcactcttacttgtttggccactgggaaaccagagccttccatttcttggcgacacatctccccatcagcaaaaccatttgaaaatggacaatatttggacatttatggaattacaagggaccaggctggggaatatgaatgcagtgcggaaaatgatgtgtcattcccagatgtgaggaaagtaaaagttgttgtcaactttgctcctactattcaggaaattaaatctggcaccgtgacccccggacgcagtggcctgataagatgtgaaggtgcaggtgtgccgcctccagcctttgaatggtacaaaggagagaagaagctcttcaatggccaacaaggaattattattcaaaattttagcacaagatccattctcactgttaccaacgtgacacaggagcacttcggcaattatacttgtgtggctgccaacaagctaggcacaaccaatgcgagcctgcctcttaaccctccaagtacagcccagtatggaattaccgggagcgctgatgttcttttctcctgctggtaccttgtgttgacactgtcctctttcaccagcatattctacctgaagaatgccattctacaataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolNEGR1-IT1, NEGR1
-
Short nameNEGR1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameneuronal growth regulator 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetneuronal growth regulator 1, NEGR1 and IDBG-99700 and ENSG00000172260 and 257194, protein binding, Plasma membranes, Negr1 and IDBG-200997 and ENSMUSG00000040037 and 320840
-
Gene info
-
Identity
-
Gene
-
Long gene nameNEGR1 intronic transcript 1
-
Synonyms gene name
- NEGR1 intronic transcript 1 (non-protein coding)
-
GenBank acession
-
Locus
-
Discovery year2011-11-22
-
Classification
- Intronic transcripts
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameneuronal growth regulator 1
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2003-09-09
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- I-set domain containing
- IgLON cell adhesion molecules
-
VEGA ID