PRKACB cloning plasmid

  • Catalog number
    CSB-CL018689HU1-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the PRKACB gene.
  • Specifications
    Gene name: PRKACB; Gene ID: 5567; Accession number: BC016285; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 774; Sequence: atggggaacgcggcgaccgccaagaaaggcagcgaggtggagagcgtgaaagagtttctagccaaagccaaagaagactttttgaaaaaatgggagaatccaactcagaataatgccggacttgaagattttgaaaggaaaaaaacccttggaacaggttcatttggaagagtcatgttggtaaaacacaaagccactgaacagtattatgccatgaagatcttagataagcagaaggttgttaaactgaagcaaatagagcatactttgaatgagaaaagaatattacaggcagtgaattttcctttccttgttcgactggagtatgcttttaaggataattctaatttatacatggttatggaatatgtccctgggggtgaaatgttttcacatctaagaagaattggaaggttcagtgagccccatgcacggttctatgcagctcagatagtgctaacattcgagtacctccattcactagacctcatctacagagatctaaaacctgaaaatctcttaattgaccatcaaggctatatccaggtcacagactttgggtttgccaaaagagttaaaggcagaacttggacattatgtggaactccagagtatttggctccagaaataattctcagcaagggctacaataaggcagtggattggtgggcattaggagtgctaatctatgaaatggcagctggctatcccccattctttgcagaccaaccaattcagatttatgaaaagattgtttctggaaagaacttttga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    PRKACB   cloning  
  • Gene symbol
    PRKACB-DT, PRKACB
  • Short name
    PRKACB cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    protein kinase, cathelicidin antimicrobial peptide-dependent, catalytic, b cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    protein kinase, cAMP-dependent, catalytic, beta, PKA C-beta and PKACB, PRKACB and IDBG-99931 and ENSG00000142875 and 5567, transferase activity, nuclei, Prkacb and IDBG-199561 and ENSMUSG00000005034 and 18749, PRKACB and IDBG-637426 and ENSBTAG00000011953 and 282323
Gene info
  • Identity
  • Gene
  • Long gene name
    PRKACB divergent transcript
  • Locus
  • Discovery year
    2020-09-17
  • Classification
    • Divergent transcripts
Gene info
  • Identity
  • Gene
  • Long gene name
    protein kinase cAMP-activated catalytic subunit beta
  • Synonyms gene name
    • protein kinase, cAMP-dependent, catalytic, beta
    • protein kinase, cAMP-dependent, beta catalytic subunit
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2001-06-22
  • Entrez gene record
  • RefSeq identity
  • Classification
    • AGC family kinases
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee