PRKACB cloning plasmid
-
Catalog numberCSB-CL018689HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PRKACB gene.
-
SpecificationsGene name: PRKACB; Gene ID: 5567; Accession number: BC016285; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 774; Sequence: atggggaacgcggcgaccgccaagaaaggcagcgaggtggagagcgtgaaagagtttctagccaaagccaaagaagactttttgaaaaaatgggagaatccaactcagaataatgccggacttgaagattttgaaaggaaaaaaacccttggaacaggttcatttggaagagtcatgttggtaaaacacaaagccactgaacagtattatgccatgaagatcttagataagcagaaggttgttaaactgaagcaaatagagcatactttgaatgagaaaagaatattacaggcagtgaattttcctttccttgttcgactggagtatgcttttaaggataattctaatttatacatggttatggaatatgtccctgggggtgaaatgttttcacatctaagaagaattggaaggttcagtgagccccatgcacggttctatgcagctcagatagtgctaacattcgagtacctccattcactagacctcatctacagagatctaaaacctgaaaatctcttaattgaccatcaaggctatatccaggtcacagactttgggtttgccaaaagagttaaaggcagaacttggacattatgtggaactccagagtatttggctccagaaataattctcagcaagggctacaataaggcagtggattggtgggcattaggagtgctaatctatgaaatggcagctggctatcccccattctttgcagaccaaccaattcagatttatgaaaagattgtttctggaaagaacttttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPRKACB-DT, PRKACB
-
Short namePRKACB cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameprotein kinase, cathelicidin antimicrobial peptide-dependent, catalytic, b cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetprotein kinase, cAMP-dependent, catalytic, beta, PKA C-beta and PKACB, PRKACB and IDBG-99931 and ENSG00000142875 and 5567, transferase activity, nuclei, Prkacb and IDBG-199561 and ENSMUSG00000005034 and 18749, PRKACB and IDBG-637426 and ENSBTAG00000011953 and 282323
-
Gene info
-
Identity
-
Gene
-
Long gene namePRKACB divergent transcript
-
Locus
-
Discovery year2020-09-17
-
Classification
- Divergent transcripts
Gene info
-
Identity
-
Gene
-
Long gene nameprotein kinase cAMP-activated catalytic subunit beta
-
Synonyms gene name
- protein kinase, cAMP-dependent, catalytic, beta
- protein kinase, cAMP-dependent, beta catalytic subunit
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-06-22
-
Entrez gene record
-
RefSeq identity
-
Classification
- AGC family kinases
-
VEGA ID