ELMO1 cloning plasmid
-
Catalog numberCSB-CL856404HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ELMO1 gene.
-
SpecificationsGene name: ELMO1; Gene ID: 9844; Accession number: BC003051; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 744; Sequence: atgcaggtggtgaaggagcaggttatgagagcacttacaaccaagcctagctccctggaccagttcaagagcaaactgcagaacctgagctacactgagatcctgaaaatccgccagtccgagaggatgaaccaggaagatttccagtcccgcccgattttggaactaaaggagaagattcagccagaaatcttagagctgatcaaacagcaacgcctgaaccgccttgtggaagggacctgctttaggaaactcaatgcccggcggaggcaagacaagttttggtattgtcggctttcgccaaatcacaaagtcctgcattacggagacttagaagagagtcctcagggagaagtgccccacgattccttgcaggacaaactgccggtggcagatatcaaagccgtggtgacgggaaaggactgccctcatatgaaagagaaaggtgcccttaaacaaaacaaggaggtgcttgaactcgctttctccatcttgtatgactcaaactgccaactgaacttcatcgctcctgacaagcatgagtactgtatctggacggatggactgaatgcgctactcgggaaggacatgatgagcgacctgacgcggaatgacctggacaccctgctcagcatggaaatcaagctccgcctcctggacctggaaaacatccagatccctgacgcacctccgccgattcccaaggagcccagcaactatgacttcgtctatgactgtaactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolELMO1-AS1, ELMO1
-
Short nameELMO1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameengulfment and cellular motility 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetengulfment and cell motility 1, CED-12 and CED12 and ELMO-1, ELMO1 and IDBG-12649 and ENSG00000155849 and 9844, SH3 domain binding, Plasma membranes, Elmo1 and IDBG-132929 and ENSMUSG00000041112 and 140580, ELMO1 and IDBG-633074 and ENSBTAG00000003490 and 509821
-
Gene info
-
Identity
-
Gene
-
Long gene nameELMO1 antisense RNA 1
-
Synonyms gene name
- ELMO1 antisense RNA 1 (non-protein coding)
-
GenBank acession
-
Locus
-
Discovery year2011-12-12
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameengulfment and cell motility 1
-
Synonyms gene name
- engulfment and cell motility 1 (ced-12 homolog, C. elegans)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-12-13
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Engulfment and cell motility proteins
- MicroRNA protein coding host genes
-
VEGA ID