CD82 cloning plasmid

• Catalog number
  CSB-CL004961HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CD82 gene.
• Specifications
  Gene name: CD82; Gene ID: 3732; Accession number: BC000726; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 804; Sequence: atgggctcagcctgtatcaaagtcaccaaatactttctcttcctcttcaacttgatcttctttatcctgggcgcagtgatcctgggcttcggggtgtggatcctggccgacaagagcagtttcatctctgtcctgcaaacctcctccagctcgcttaggatgggggcctatgtcttcatcggcgtgggggcagtcactatgctcatgggcttcctgggctgcatcggcgccgtcaacgaggtccgctgcctgctggggctgtactttgctttcctgctcctgatcctcattgcccaggtgacggccggggccctcttctacttcaacatgggcaagctgaagcaggagatgggcggcatcgtgactgagctcattcgagactacaacagcagtcgcgaggacagcctgcaggatgcctgggactacgtgcaggctcaggtgaagtgctgcggctgggtcagcttctacaactggacagacaacgctgagctcatgaatcgccctgaggtcacctacccctgttcctgcgaagtcaagggggaagaggacaacagcctttctgtgaggaagggcttctgcgaggcccccggcaacaggacccagagtggcaaccaccctgaggactggcctgtgtaccaggagggctgcatggagaaggtgcaggcgtggctgcaggagaacctgggcatcatcctcggcgtgggcgtgggtgtggccatcgtcgagctcctggggatggtcctgtccatctgcttgtgccggcacgtccattccgaagactacagcaaggtccccaagtactga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CD82   cloning  
• Gene symbol
  CD82
• Short name
  CD82 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  CD82 molecule cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  CD82 molecule, 4F9 and C33 and GR15 and IA4 and KAI1 and R2 and SAR2 and ST6 and TSPAN27, CD82 and IDBG-40873 and ENSG00000085117 and 3732, protein binding, Plasma membranes, Cd82 and IDBG-192552 and ENSMUSG00000027215 and 12521, CD82 and IDBG-636903 and ENSBTAG00000031252 and 100335281,506713

Gene info

• Identity
  HGNC:6210
• Gene
  CD82
• Long gene name
  CD82 molecule
• Synonyms gene
  • ST6
  • KAI1
• Synonyms gene name
  • kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocyte antigen, antigen detected by monoclonal and antibody IA4))
  • CD82 antigen
• Synonyms
  • R2
  • IA4
  • TSPAN27
• Synonyms name
  • suppression of tumorigenicity 6
  • R2 leukocyte antigen
• GenBank acession
  • U20770
• Locus
  11p11.2
• Discovery year
  1994-01-10
• Entrez gene record
  3732
• RefSeq identity
  • NM_002231
• Classification
  • Tetraspanins
  • CD molecules
• VEGA ID
  OTTHUMG00000166472

Similar products