MRAP cloning plasmid
-
Catalog numberCSB-CL851545HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the MRAP gene.
-
SpecificationsGene name: MRAP; Gene ID: 56246; Accession number: BC062721; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 519; Sequence: atggccaacgggaccaacgcctctgccccatactacagctatgaatactacctggactatctggacctcattcccgtggacgagaagaagctgaaagcccacaaacattccatcgtgatcgcattctgggttagcctggctgccttcgtggtgctgctcttcctcatcttgctctacatgtcctggtccgcctccccgcagatgaggaacagccccaagcaccaccaaacatgcccctggagtcacggcctcaacctccacctctgcatccagaagtgcctgccgtgccacagggaacccctggcaacctcacaggctcaggcgagctcagtggagccagggagcagaactggccctgaccagccgctacgacaggagagctcctccacgttgcccctcgggggtttccagacccaccccactctcctctgggaactgaccctcaatgggggtcccctcgtcaggagcaagcccagcgagcctccccctggagacaggacctctcaattgcagagctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolMRAP-AS1, MRAP
-
Short nameMRAP cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namemelanocortin 2 receptor accessory protein cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetmelanocortin 2 receptor accessory protein, MRAP and IDBG-1657 and ENSG00000170262 and 56246, type 1 melanocortin receptor binding, Plasma membranes, Mrap and IDBG-174947 and ENSMUSG00000039956 and 77037, MRAP and IDBG-629951 and ENSBTAG00000023718 and 505743
-
Gene info
-
Identity
-
Gene
-
Long gene nameMRAP antisense RNA 1
-
Locus
-
Discovery year2019-08-16
-
Entrez gene record
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene namemelanocortin 2 receptor accessory protein
-
Synonyms gene
-
Synonyms gene name
- chromosome 21 open reading frame 61
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2000-08-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID