BLOC1S1 cloning plasmid
-
Catalog numberCSB-CL002718HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the BLOC1S1 gene.
-
SpecificationsGene name: BLOC1S1; Gene ID: 2647; Accession number: BC130640; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 378; Sequence: atgctgtcccgcctcctaaaagaacaccaggccaagcagaatgaacgcaaggagctgcaggaaaagaggaggcgagaggctatcactgcagcgacctgcctgacagaagctttggtggatcacctcaatgtgggtgtggcccaggcctacatgaaccagagaaagctggaccatgaggtgaagaccctacaggtccaggctgcccaatttgccaagcagacaggccagtggatcggaatggtggagaacttcaaccaggcactcaaggaaattggggatgtggagaactgggctcggagcatcgagctggacatgcgcaccattgccactgcactggaatatgtctacaaagggcagctgcagtctgccccttcctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolBLOC1S1
-
Short nameBLOC1S1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameUncharacterized protein cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetUncharacterized protein, BLOC1S1 and IDBG-546922 and ENSG00000258311 and, protein binding, Extracellular, Bloc1s1 and IDBG-486103 and ENSMUSG00000090247 and 14533,666114, BLOC1S1 and IDBG-636497 and ENSBTAG00000011918 and 615149
-
Gene info
-
Identity
-
Gene
-
Long gene namebiogenesis of lysosomal organelles complex 1 subunit 1
-
Synonyms gene
-
Synonyms gene name
- GCN5 general control of amino-acid synthesis 5-like 1 (yeast)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1995-11-15
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Biogenesis of lysosomal organelles complex 1 subunits
- BLOC-1 related complex subunits
-
VEGA ID