TRIP6 cloning plasmid

• Catalog number
  CSB-CL620889HU3-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the TRIP6 gene.
• Specifications
  Gene name: TRIP6; Gene ID: 7205; Accession number: BC002680; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1425; Sequence: atgtcggggcccacctggctgcccccgaagcagccggagcccgccagagcccctcaggggagggcgatcccccgcggcaccccggggccaccaccggcccacggagcagcactccaccccagggtcaatttttgcccccttccatctgagcagtgttaccaggccccagggggaccggaggatcgggggccggcgtgggtggggtcccatggagtactccagcacacgcaggggctccctgcagacagggggggccttcgccctggaagcctggacgccgagatagacttgctgagcagcacgctggccgagctgaatgggggtcggggtcatgcgtcacggcgaccagaccgacaggcatatgagcccccgccacctcctgcctaccgcacgggctccctgaagccaaatccagcctcgccgctcccagcgtctccctatgggggccccactccagcctcttacactaccgccagcaccccggctggcccagccttccccgtgcaagtgaaggtggcacagccagtgaggggctgcggcccacccaggcggggagcctctcaggcctctgggcccctcccgggcccccactttcctctcccaggccgaggtgaagtctgggggcctggctataggagccagagagagccagggccaggggccaaagaggaagctgctgggatctctggccctgcaggaagaggaagaggaggcgagcacgggccccaggtgcccctgagccagcctccagaggatgagctggataggctgacgaagaagctggttcacgacatgaaccacccgcccagcggggagtactttggccagtgtggtggctgcggagaagatgtggttggggatggggctggggttgtggcccttgatcgcgtctttcacgtgggctgctttgtgtgttctacatgccgggcccagcttcgcggccagcatttctacgccgtggagaggagggcatattgcgagggctgctacgtggccaccctggagaaatgtgccacgtgctcccagcccatcctggaccggatcctgcgggctatggggaaggcctaccaccctggctgcttcacctgcgtggtgtgtcaccgcggcctcgacggcatccccttcacagtggatgctacgagccagatccactgcattgaggactttcacaggaagtttgccccaagatgctcagtgtgcggtggggccataatgcctgagccaggtcaggaggagactgtgagaattgttgctctggatcgaagttttcacattggctgttacaagtgcgaggagtgtgggctgctgctctcctctgagggcgagtgtcagggctgctacccgctggatgggcacatcttgtgcaaggcctgcagcgcctggcgcatccaggagctctcagccaccgtcaccactgactgctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  TRIP6   cloning  
• Gene symbol
  TRIP6
• Short name
  TRIP6 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  thyroid hormone receptor interactor 6 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  thyroid hormone receptor interactor 6, OIP-1 and OIP1 and TRIP-6 and TRIP6i2 and ZRP-1, TRIP6 and IDBG-32241 and ENSG00000087077 and 102466755,7205, thyroid hormone receptor binding, nuclei, Trip6 and IDBG-204924 and ENSMUSG00000023348 and 22051, TRIP6 and IDBG-640448 and ENSBTAG00000024772 and 615869

Gene info

• Identity
  HGNC:12311
• Gene
  TRIP6
• Long gene name
  thyroid hormone receptor interactor 6
• Synonyms
  • ZRP-1
  • OIP1
  • MGC10556
  • MGC10558
  • MGC29959
  • MGC3837
  • MGC4423
• GenBank acession
  • L40374
  • AF000974
• Locus
  7q22.1
• Discovery year
  1997-10-16
• Entrez gene record
  7205
• Pubmed identfication
  • 9598321
  • 7776974
• RefSeq identity
  • NM_003302
• Classification
  • Zyxin family
  • MicroRNA protein coding host genes
• VEGA ID
  OTTHUMG00000157029

Similar products