IGLL1 cloning plasmid
-
Catalog numberCSB-CL011471HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the IGLL1 gene.
-
SpecificationsGene name: IGLL1; Gene ID: 3543; Accession number: BC012293; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 642; Sequence: atgaggccagggacaggccaggggggccttgaggcccctggtgagccaggccccaacctcaggcagcgctggcccctgctgctgctgggtctggccgtggtaacccatggcctgctgcgcccaacagctgcatcgcagagcagggccctgggccctggagcccctggaggaagcagccggtccagcctgaggagccggtggggcaggttcctgctccagcgcggctcctggactggccccaggtgctggccccgggggtttcaatccaagcataactcagtgacgcatgtgtttggcagcgggacccagctcaccgttttaagtcagcccaaggccaccccctcggtcactctgttcccgccgtcctctgaggagctccaagccaacaaggctacactggtgtgtctcatgaatgacttttatccgggaatcttgacggtgacctggaaggcagatggtacccccatcacccagggcgtggagatgaccacgccctccaaacagagcaacaacaagtacgcggccagcagctacctgagcctgacgcccgagcagtggaggtcccgcagaagctacagctgccaggtcatgcacgaagggagcaccgtggagaagacggtggcccctgcagaatgttcatag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolIGLL1
-
Short nameIGLL1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameimmunoglobulin lambda-like polypeptide 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetimmunoglobulin lambda-like polypeptide 1, 14.1 and AGM2 and CD179b and IGL1 and IGL5 and IGLJ14.1 and IGLL and I this GO and IGVPB and VPREB2, IGLL1 and IDBG-2433 and ENSG00000128322 and 3543, protein binding, Plasma membranes
-
Gene info
-
Identity
-
Gene
-
Long gene nameimmunoglobulin lambda like polypeptide 1
-
Synonyms gene
-
Synonyms gene name
- immunoglobulin lambda-like polypeptide 1
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1991-09-12
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- C1-set domain containing
- CD molecules
-
VEGA ID
-
Locus Specific Databases