BAG1 cloning plasmid
-
Catalog numberCSB-CL859527HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the BAG1 gene.
-
SpecificationsGene name: BAG1; Gene ID: 573; Accession number: BC001936; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 825; Sequence: atgaagaagaaaacccggcgccgctcgacccggagcgaggagttgacccggagcgaggagttgaccctgagtgaggaagcgacctggagtgaagaggcgacccagagtgaggaggcgacccagggcgaagagatgaatcggagccaggaggtgacccgggacgaggagtcgacccggagcgaggaggtgaccagggaggaaatggcggcagctgggctcaccgtgactgtcacccacagcaatgagaagcacgaccttcatgttacctcccagcagggcagcagtgaaccagttgtccaagacctggcccaggttgttgaagaggtcataggggttccacagtcttttcagaaactcatatttaagggaaaatctctgaaggaaatggaaacaccgttgtcagcacttggaatacaagatggttgccgggtcatgttaattgggaaaaagaacagtccacaggaagaggttgaactaaagaagttgaaacatttggagaagtctgtggagaagatagctgaccagctggaagagttgaataaagagcttactggaatccagcagggttttctgcccaaggatttgcaagctgaagctctctgcaaacttgataggagagtaaaagccacaatagagcagtttatgaagatcttggaggagattgacacactgatcctgccagaaaatttcaaagacagtagattgaaaaggaaaggcttggtaaaaaaggttcaggcattcctagccgagtgtgacacagtggagcagaacatctgccaggagactgagcggctgcagtctacaaactttgccctggccgagtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolBAG1
-
Short nameBAG1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameB-cellular CLL/lymphoma 2-associated athanogene cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetBCL2-associated athanogene, BAG-1 and HAP and RAP46, BAG1 and IDBG-56882 and ENSG00000107262 and 573, phosphoprotein binding, nuclei, Bag1 and IDBG-136600 and ENSMUSG00000028416 and 12017, BAG1 and IDBG-635765 and ENSBTAG00000017845 and 613855,781741
-
Gene info
-
Identity
-
Gene
-
Long gene nameBAG cochaperone 1
-
Synonyms gene name
- BCL2 associated athanogene
- BCL2 associated athanogene 1
-
GenBank acession
-
Locus
-
Discovery year1996-06-19
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- BAG cochaperones
-
VEGA ID