BAG1 cloning plasmid

• Catalog number
  CSB-CL859527HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the BAG1 gene.
• Specifications
  Gene name: BAG1; Gene ID: 573; Accession number: BC001936; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 825; Sequence: atgaagaagaaaacccggcgccgctcgacccggagcgaggagttgacccggagcgaggagttgaccctgagtgaggaagcgacctggagtgaagaggcgacccagagtgaggaggcgacccagggcgaagagatgaatcggagccaggaggtgacccgggacgaggagtcgacccggagcgaggaggtgaccagggaggaaatggcggcagctgggctcaccgtgactgtcacccacagcaatgagaagcacgaccttcatgttacctcccagcagggcagcagtgaaccagttgtccaagacctggcccaggttgttgaagaggtcataggggttccacagtcttttcagaaactcatatttaagggaaaatctctgaaggaaatggaaacaccgttgtcagcacttggaatacaagatggttgccgggtcatgttaattgggaaaaagaacagtccacaggaagaggttgaactaaagaagttgaaacatttggagaagtctgtggagaagatagctgaccagctggaagagttgaataaagagcttactggaatccagcagggttttctgcccaaggatttgcaagctgaagctctctgcaaacttgataggagagtaaaagccacaatagagcagtttatgaagatcttggaggagattgacacactgatcctgccagaaaatttcaaagacagtagattgaaaaggaaaggcttggtaaaaaaggttcaggcattcctagccgagtgtgacacagtggagcagaacatctgccaggagactgagcggctgcagtctacaaactttgccctggccgagtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  BAG1   cloning  
• Gene symbol
  BAG1
• Short name
  BAG1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  B-cellular CLL/lymphoma 2-associated athanogene cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  BCL2-associated athanogene, BAG-1 and HAP and RAP46, BAG1 and IDBG-56882 and ENSG00000107262 and 573, phosphoprotein binding, nuclei, Bag1 and IDBG-136600 and ENSMUSG00000028416 and 12017, BAG1 and IDBG-635765 and ENSBTAG00000017845 and 613855,781741

Gene info

• Identity
  HGNC:937
• Gene
  BAG1
• Long gene name
  BAG cochaperone 1
• Synonyms gene name
  • BCL2 associated athanogene
  • BCL2 associated athanogene 1
• GenBank acession
  • AF022224
• Locus
  9p13.3
• Discovery year
  1996-06-19
• Entrez gene record
  573
• Pubmed identfication
  • 7834747
• RefSeq identity
  • NM_004323
• Classification
  • BAG cochaperones
• VEGA ID
  OTTHUMG00000019766

Similar products