PBX2 cloning plasmid

  • Catalog number
    CSB-CL017506HU2-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the PBX2 gene.
  • Specifications
    Gene name: PBX2; Gene ID: 5089; Accession number: BC082261; Vector: pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1293; Sequence: atggacgaacggctactggggccgccccctccaggcgggggccgggggggcctgggattggtgagtggggagcctgggggccctggcgagcctcccggtggcggagaccccggtgggggtagcgggggggtcccgggaggccgagggaagcaagacatcggggacattctgcagcagataatgaccatcaccgaccagagcctggacgaggcccaggccaagaaacacgccctaaactgccaccgaatgaagcctgctctctttagcgtcctgtgtgaaatcaaggagaaaactggcctcagcattcggagctcccaggaggaggagccggtggacccacagctgatgcgcttggacaacatgcttctggcagagggtgtggctgggcccgagaaagggggcggctcagcagcagcagctgcagccgctgcagcctctggtggtggtgtgtcccctgacaactccatcgaacactcggactatcgcagcaaacttgcccagatccgtcacatataccactcggagctggagaagtatgagcaggcatgtaatgagttcacgacccatgtcatgaacctgctgagggagcagagccgcaccaggcccgtggcccccaaagagatggaacgcatggtgagcatcatccatcgaaagttcagcgccatccagatgcagctgaagcagagcacctgcgaggctgtgatgatcctgcgctcccgtttcctggatgccagacgaaagcgccgtaacttcagcaaacaggccactgaggtcctaaatgagtatttctactcccacctgagtaacccatatcctagtgaggaggccaaggaggagcttgccaagaagtgtggcatcaccgtgtctcaggtctccaactggtttggcaacaagaggattcgctataagaaaaacatcggaaagttccaagaggaggcaaacatctatgctgtcaagaccgccgtgtcagtcacccaggggggccacagccgcaccagctccccgacacccccttcctctgcaggctctggcggctctttcaatctctcaggatctggagacatgtttctggggatgcctgggctcaacggagattcctattctgcttcccaggtggaatcactccgacactcgatggggccagggggctatggggataacctcgggggaggccagatgtacagcccacgggaaatgagggcaaatggcagctggcaagaggctgtgaccccctcttcagtgacatccccaacggagggaccagggagtgttcactctgatacctccaactga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    PBX2   cloning  
  • Gene symbol
    PBX2P1, PBX2
  • Short name
    PBX2 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    pre-B-cell leukemia homeobox 2 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    pre-B-cell leukemia homeobox 2, G17 and HOX12 and PBX2MHC, PBX2 and IDBG-80565 and ENSG00000204304 and 5089, transcription factor binding, nuclei, Pbx2 and IDBG-172072 and ENSMUSG00000034673 and 18515, PBX2 and IDBG-633030 and ENSBTAG00000014421 and 100139739
Gene info
  • Identity
  • Gene
  • Long gene name
    PBX homeobox 2 pseudogene 1
  • Synonyms gene
  • Synonyms gene name
    • pre-B-cell leukemia transcription factor pseudogene 1
    • pre-B-cell leukemia homeobox 2 pseudogene 1
  • Locus
  • Discovery year
    1990-09-10
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • TALE class homeoboxes and pseudogenes
  • VEGA ID
Gene info
  • Identity
  • Gene
  • Long gene name
    PBX homeobox 2
  • Synonyms gene name
    • pre-B-cell leukemia transcription factor 2
    • pre-B-cell leukemia homeobox 2
  • Synonyms
  • Locus
  • Discovery year
    1994-12-13
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • TALE class homeoboxes and pseudogenes
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee